|
|
Allenopithecus nigroviridis - Allen's Swamp Monkey, Cercopithèque De AllenIUCN Status: Lower Risk/Near ThreatenedIUCN Species Profile http://www.zooregon.org/Cards/Rainforest/monkey.allens.swamp.htm Oregon Zoo Animals: Allen's Swamp Monkey: Allen's Swamp Monkey. scientific name. Allenopithecus nigroviridis. size/weight/height. Head/Body Length: 18-20" Tail: 19-20" Weight: 7.7 - 13 lbs. ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=572992 ITIS Standard Report Page: Allenopithecus nigroviridis: Allenopithecus nigroviridis (Pocock, 1907) Taxonomic Serial No.: 572992. ... Species, Allenopithecus nigroviridis (Pocock, 1907) -- Allen's swamp monkey, References, ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=572820 ITIS Standard Report Page: Allenopithecus: Genus, Allenopithecus Lang, 1923, Direct Children: Species, Allenopithecus nigroviridis (Pocock, 1907) -- Allen's swamp monkey, References, Expert(s): ... http://members.tripod.com/uakari/allenopithecus_nigroviridis.html Allen's Swamp Monkey (Allenopithecus nigroviridis): Allen’s Swamp Monkey (Allenopithecus nigroviridis). ... Quelques caracteristiques ecologiques du singe des marais: Allenopithecus nigroviridis Lang 1923. Rev. ... http://members.tripod.com/cacajao/allenopithecus_links.html Allenopithecus Links: Allenopithecus Links. African Mammals Databank: Allenopithecus nigroviridis (Allen's Swamp Monkey) Animal Diversity Web: Allenopithecus nigroviridis (Allen's ... http://www.gisbau.uniroma1.it/amd/amd061.html PRIMATES: Primates Id code: amd061. Cercopithecidae. Allenopithecus nigroviridis. (Pocock, 1907). (Eng) Allen's swamp monkey. (Fre) Cercopithèque noir et vert. ... http://www.quantum-conservation.org/EEP/ALLENOPITHECUS%20NIGROVIRIDIS.html ALLENOPITHECUS NIGROVIRIDIS: ALLEN'S SWAMP MONKEY ALLENOPITHECUS NIGROVIRIDIS Dr. Jean-Luc Berthier Menagerie du Jardin des Plantes MNHN 57, rue Cevier 75231 Paris Cedex 05 France Dr. Jean ... http://www.quantum-conservation.org/STDBK98.html BLACK STORK CICONIA NIGRA: Bristol BS8 3HA. United Kingdom. ALLEN'S SWAMP MONKEY. ALLENOPITHECUS NIGROVIRIDIS. Dr. Jean-Luc Berthier. Menagerie du Jardin des Plantes. MNHN 57, rue Cevier. ... http://www.primatis.de/primaten/fakten.asp?ID=2211101 primatis.de - Ordnung und Steckbriefe der lebenden Primatenarten: ...- ... WISSENSCHAFTLICH, Allenopithecus nigroviridis. DEUTSCH, Sumpfmeerkatzen, Schwarzegrüne Meerkatze. ENGLISCH, Allen's (swamp) monkey, Swamp guenon. ... http://www.primatis.de/primaten/fakten.asp primatis.de - Ordnung und Steckbriefe der lebenden Primatenarten: ...- ... Unterfamilie: Cercopithecinae - Meerkatzenartige Art: Allenopithecus nigroviridis - Sumpfmeerkatzen, Schwarzegrüne Meerkatze Art: Cercocebus albigena ... http://www.damisela.com/zoo/mam/primates/cercopithecidae/nigroviridis/ Mono de Allen: ...- Mono de Allen. Allenopithecus nigroviridis. ... http://www.damisela.com/zoo/mam/primates/cercopithecidae/nigroviridis/taxa.htm Allenopithecus nigroviridis: ...- Clasificación del Mono de Allen ( Allenopithecus nigroviridis ) en el Reino Animal. Mono de Allen. Allenopithecus nigroviridis. TaxonomÃa. ... http://www.ipbir.org/ipbir_cgi/tax.cgi?mode=2&id=6&lvl=2 IPBIR: Integrated Primate Biomaterials and Information Resource ...: Origin. PR00085, Allenopithecus nigroviridis, Allen's swamp monkey, Cell Culture Skin, 1 YR, Female, born in captivity. PR00087, Allenopithecus ... http://www.ipbir.org/ipbir_cgi/tax.cgi?mode=2&id=69&lvl=5 IPBIR: Integrated Primate Biomaterials and Information Resource ...: 8 samples submitted under Allenopithecus nigroviridis. ... PR00085, Allenopithecus nigroviridis, Allen's swamp monkey, Cell Culture Skin, 1 YR, Female, born in captivity. ... http://www.floranimal.ru/pages/animal/m/478.html ÐœÐ?РТЫШКÐ? Ð?ЛЕÐ?Ð?Ð?: ГлавнаÑ?, Ðто интереÑ?но! Форумы, ОбъÑ?влениÑ?, Партнёры, CÑ?ылки, ОбратнаÑ? Ñ?вÑ?зь, О наÑ?, ... http://www.karlsruhe.de/Zoo/sumpf.htm Stadt-Zoo Karlsruhe - Die Sumpfmeerkatze: ...- Sumpfmeerkatze. Allenopithecus nigroviridis Allen`s swamp monkey/ Cercopihèque noir et vert. Verbreitung: Ostafrika. Oberer Kongofluß, Victoriasee. ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=Allenopithecus+nigroviridis+%5Bgbpri%5D Codon usage table: Allenopithecus nigroviridis [gbpri]: 1 CDS's (318 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 9.4( 3) UCU ... http://www.sandiegozoo.org/animalbytes/t-monkey.html Animal Bytes: Monkey: Some monkeys can swim, like Debrazza guenons Cercopithecus neglectus, Allen’s swamp monkeys Allenopithecus nigroviridis, and proboscis monkeys Nasalis ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?doptcmdl=ExternalLink&cmd=Search&db=Taxonomy&term=LoProvIPBIR%5BSB%5D Entrez Taxonomy: MOLECULAR BIOLOGY DATABASES: Taxonomy/phylogenetic: Animal Diversity Web Allenopithecus nigroviridis. Integrated Taxonomic Information ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=12758172 Screening for simian foamy virus infection by using a combined ...: We also isolated SFV from the blood of four seropositive primates (Allenopithecus nigroviridis, Trachypithecus francoisi, Hylobates pileatus, and H. leucogenys ... http://www.primate.wisc.edu/pin/review/allens.html Primate-Science Review Copies Received: Books Received Primate-Science / PrimateLit. ALLEN'S SWAMP MONKEY (ALLENOPITHECUS NIGROVIRIDIS) 2000 NORTH AMERICA REGIONAL STUDBOOK. ... http://www.primate.wisc.edu/pin/factsheets.html PIN: Fact Sheets: Allenopithecus Back to Top. African Mammals Databank: Allenopithecus nigroviridis (Allen's Swamp Monkey) Animal Diversity Web: Allenopithecus nigroviridis ... http://www.funet.fi/pub/sci/bio/life/mammalia/primates/cercopithecidae/allenopithecus/ Allenopithecus: Mus. Novit. 87: 1 NW.Zaire, NE.Angola. See [About maps]. Allenopithecus nigroviridis (Pocock, 1907) nigroviridis (Pocock, 1907); Proc. Zool. Soc. Lond. ... http://www.funet.fi/pub/sci/bio/life/warp/mammals-index-n.html All (in this database) Mammals list (Scientific names): Tadarida teniotis; nigroviridis (Allenopithecus); nigroviridis (Cecropithecus), see Allenopithecus nigroviridis; nigrovittatus (Callosciurus ... http://staff.washington.edu/timk/primate/photos/Allenopithecus.html Primate Gallery - Allenopithecus: Allen's Swamp Monkey Allenopithecus nigroviridis (Pocock, 1907) Distribution: NW Zaire, NE Angola. Status: CITES - Appendix II; IUCN - Insufficiently known. ... http://staff.washington.edu/timk/primate/photos/species.html Living Primate Species: ...[ Table of Contents ]. Subfamily Cercopithecinae. Allenopithecus. Allen's Swamp Monkey Allenopithecus nigroviridis (Pocock, 1907). Cercocebus - Mangabeys. ... http://web.whittier.edu/academic/anthropology/mbaker/enrichment.htm Manufacture and Selection of Items for Habitat Enrichment for ...: 4. Allen’s Swamp Monkeys (Allenopithecus nigroviridis). Schmidt’s Spot-nosed Guenons (Cercopithecus ascanius schmidti). ... (Allenopithecus nigroviridis). ... http://www.primates.com/classification/ Living Primates: Miopithecus: (Miopithecus talapoin) Talapoi. Allenopithecus: (Allenopithecus nigroviridis) Allen's swamp monkey. Erythrocebus: (Erythrocebus ... http://home.globalcrossing.net/~brendel/primate.html PRIMATES (prosimians, monkeys, apes and humans): Miopithecus talapoin (talapoi). Genus Allenopithecus. Allenopithecus nigroviridis (Allen's swamp monkey). Genus Erythrocebus. Erythrocebus patas (Patas monkey). ... http://www.primatestore.com/taxonomycommon.htm Primate Taxonomy Common -> Primate Scientific Names: Allen's swamp monkey - Allenopithecus nigroviridis Banded leaf monkey - Presbytis melalophos Black spider monkey - Ateles paniscus Black-handed spider monkey ... http://www.primatestore.com/taxonomyscientific.htm Primate Taxonomy Scientific -> Primate Common Names: Taxonomy - Scientific. Allenopithecus nigroviridis - Allen's swamp monkey. Allocebus trichotis - Hairy-eared dwarf lemur. Alouatta - Howler. ... http://www.monkeymaddness.com/taxonomy_photos/species.html Monkey Maddness - Taxonomy List: ...earr Callithrix kuhli Mona, crowned Cercopithecus pogonias Mona, Wolf's Cercopithecus wolfi Monkey, Allen's swamp Allenopithecus nigroviridis Monkey, Banded ... http://www.infochembio.ethz.ch/links/zool_saeuget_affenalt.html Altweltaffen: Säugetiere: Allen's Swamp Monkey (Allenopithecus nigroviridis) - Text and Images. ... Sumpfmeerkatzen, Schwarzegrüne Meerkatze (Allenopithecus nigroviridis) - Text. ... http://www.origins.tv/darwin/zoo/oldmonk.htm Zoology -- Old World Monkeys: Cercopithecidae. Cercopithecinae. Allenopithecus nigroviridis -- Allen's Swamp Monkey -- [ *wisc | amd | *vzoo | *ozoo ] Cercocebus ... http://nl.wikipedia.org/wiki/Primates_(taxonomie) Primates (taxonomie) - Wikipedia NL: ...van de oude wereld): Onderfamilie: Cercopithecinae: Geslacht: Allenopithecus: Soort: Allenopithecus nigroviridis (Allen's moerasaap). ... http://www.netbiologen.dk/zoologi/primater.htm Familie Cheirogaleidae: Miopithecus. Miopithecus talapoin Talapoi. Allenopithecus. Allenopithecus nigroviridis Allen's swamp Marekat. Erythrocebus. Erythrocebus patas Patas Marekat. ... http://www.markuskappeler.ch/tex/texs/dianameerkatze.html Dianameerkatze: ...- ... Theropithecus gelada), den Husarenaffen (Erythrocebus patas), die Zwergmeerkatze (Miopithecus talapoin) und die Sumpfmeerkatze (Allenopithecus nigroviridis). ... http://getentry.ddbj.nig.ac.jp/cgi-bin/get_entry.pl?AY190030 Get Entry: LOCUS AY190030 1296 bp DNA linear PRI 20-JAN-2003 DEFINITION Allenopithecus nigroviridis LXR-alpha (NR1H2) gene, exons 2 and 3 and partial cds. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasPrim.html Classification des Primates: Cercocebus Cercopithecus Chlorocebus Erythrocebus Lophocebus Macaca Mandrillus Miopithecus Papio Theropithecus, Allenopithecus nigroviridis Cercocebus agilis ... http://poepping.de/gesetze/import.htm Verordnung zum Importverbot in die EU: ...- ... Herrentiere - Primates. Schwarzgrüne Meerkatze, Allenopithecus nigroviridis, Wildfänge, Alle, Alle. Brauner Brüllaffe, Alouatta fusca, Wildfänge, Alle, Alle. ... http://www.informationblast.com/Old_World_monkeys.html Old World monkey - InformationBlast: Allenopithecus: Allen's Swamp Monkey, Allenopithecus nigroviridis; Africa. Genus Cercocebus: Agile Mangabey, Cercocebus agilis; Africa; ... http://mitglied.lycos.de/tierseiten/affen/affensystematik.html Systematik der Primaten: ...- ... Art: Cercopithecus talapoin (Zwergmeerkatze) Untergattung: Allenopithecus Art: Cercopithecus (Allenopithecus) nigroviridis (Schwarzgrüne Meerkatze) Gattung ... http://212.187.155.84/pass_06june/subdirectories_for_search/SpeciesKingdoms/0Families_ACrM_Primates/cercopithecidae/Allenopithecus/Allenopithecus.htm Allenopithecus - (Genus): Species. Allenopithecus nigroviridis - Allen's swamp monkey (Link page only). Genus Synonyms, -- (B141). References. Primary Reference at the level of this taxa. ... http://www.wanprc.org/psic/taxonomy.asp PSIC-Taxonomy: Cercopithecus wolfi, Wolf's monkey. * Allenopithecus : Allen's swamp monkeys, Allenopithecus nigroviridis, Allen's swamp monkey. * Chlorocebus : Vervet monkeys, ... http://www.panda.org/about_wwf/where_we_work/ecoregions/global200/pages/regions/region005.htm WWF - Global 200: A large number of mammals roam the forests, such as. endemic bonobo (Pan paniscus); Allen’s swamp monkey (Allenopithecus nigroviridis); ... http://www.panda.org/about_wwf/where_we_work/ecoregions/global200/pages/regions/region143.htm WWF - Global 200: Endemic or near-endemic aquatic mammals include giant otter shrew (Potamogale velox) and Allen’s swamp monkey (Allenopithecus nigroviridis). ... http://www.wcs-congo.org/noufeat2.htm WCS-Congo: Nouabalé-Ndoki Mammal List: Cercopithecidae Cercopithecidae Colobidae Colobidae Galagonidae Loridae Loridae Pongidae Pongidae, Allenopithecus nigroviridis Lophocebus albigena Cercocebus ... http://www.wcs-congo.org/resfeat4.htm WCS-Congo: Nouabalé-Ndoki Mammal List: 81 Maisels, F., Blake, S., Fay, M., Yako, V., & Mobolambi, G. (in press) A note on the distribution of Allen's swamp monkey Allenopithecus nigroviridis in North ... http://www.enviro.co.za/vervet/cercopit.htm cercopithecidae: Allenopithecus nigroviridis Cercocebus albigena Cercocebus aterrimus Cercocebus galeritus Cercocebus torquatus Cercopithecus aethiops Cercopithecus ascanius ... http://www.phthiraptera.org/Mammals/Cercopithecidae.html Mammals: Cercopithecidae: Pedicinus [Anoplura: Pedicinidae]. Cercopithecinae. Allenopithecus. Allenopithecus nigroviridis (Pocock, 1907) - Allen's Swamp Monkey Cercocebus - Mangabeys. ... http://www.leszoosdanslemonde.com/html/europe/zoo_france/liste_especes.htm Liste des espèces présentées dans les espaces zoologiques ...: ...- ... Palmyre, ZooParc de Beauval, Zoo de La Flèche, Parc de Branféré, Zoo des Sables d'Olonne, Safari de Thoiry Allenopithecus nigroviridis, Cercopithèque noir ... http://www.bonobo.org/species.htm :: Bonobo Conservation Initiative :: Broadcast: Primates: Bonobo (Pan paniscus EN), Tshuapa/Thollon's red colobus (Procolobus p. tholloni-EN,DD, Allen's swamp monkey (Allenopithecus nigroviridis-LR,nt ... http://www.unipv.it/webbio/cismu/prim/taxapril.htm Primate taxonomy with links to resources: Cercopithecus Macaca Erythrocebus Cercocebus Papio Theropithecus, Cercopithecus (Allenopithecus) nigroviridis Cercopithecus (Chlorocebus) aethiops | b ... http://intron.bic.nus.edu.sg/chk/gbpri2.out Seq ID=LOCUS AAU18601 1771 bp DNA PRI 17-JAN-1997 ORGANISM Aotus ...: ...- ... 1 ===== Seq ID=LOCUS ANLZM1 136 bp DNA PRI 23-JAN-1997 ORGANISM Allenopithecus nigroviridis Eukaryota; Metazoa ... http://www.didac.ehu.es/antropo/0/0-5/romagno.htm Antropo, 2001: Romagno et al: ...- ... ai cariotipi bandeggiati di: C. mitis (maesi), C. albogoularis e C. nictitans (stampflii) (Sineo, 1990); Allenopithecus nigroviridis, Erythrocebus patas ... http://www.arcbc.org/cgi-bin/abiss.exe/ld?ld=sp_list.htm&tx=MA Species List: Dipodidae Allactodipus bobrinskii, Cercopithecidae Allenopithecus nigroviridis, Cheirogaleidae Allocebus trichotis, Muridae Allocricetulus curtatus, ... http://www.receptors.org/NR/seq/DR/Q866P5.TABDR.html NucleaRDB Cross References for Q866P5: Description, LXR-alpha (Fragment). Gene, NR1H2. Organism, Allenopithecus nigroviridis (Allen's swamp monkey). Chromosomal location, -. Gene Ontology, QuickGO. ... http://www.receptors.org/NR/htmls/entries_org.html NucleaRDB Nuclear receptor entries: Q9U3Y4 (Q9U3Y4) ECR 1H1 Ecdysone Aedes albopictus (Forest day mosquito). Q866P5 (Q866P5) NR1H2 fragment Allenopithecus nigroviridis (Allen's swamp monkey). ... http://weber.ucsd.edu/~jmoore/apesites/Ndoki/Ndoki.html Ndoki, RP Congo: Galago elegans, Colobus guereza, C. badius, Cercopithecus pogonias, C. nictitans, C. neglectus, C. cephus, Allenopithecus nigroviridis, Cercocebus albigena ... http://weber.ucsd.edu/~jmoore/apesites/Wamba/Wamba.html Wamba, DR Congo: Galago demidovii, Colobus angolensis, C. badius, Cercopithecus ascanius, C. wolfi, C. neglectus, C. salongo, Allenopithecus nigroviridis, Cercocebus aterrimus ... http://etologia1.psi.ub.es/etopri/tcercop.htm tcercop: Cercopithecinae, Cercopithecus, aethiops, Vervet monkey. Cercopithecinae, Allenopithecus, nigroviridis, Allen's swamp monkey. Cercopithecinae, ... http://www.fmnh.helsinki.fi/users/haaramo/Metazoa/Deuterostoma/Chordata/Synapsida/Eutheria/Primates/Cercopithecoidea/Cercopithecini.htm Cercopithecidae: Cercopithecinae: Cercopithecini: Miopithecus talapoin [Cercopithecus] (talapoin, kellanvihreä kääpiömarakatti) |-- Allenopithecus nigroviridis (suomarakatti) |-- Erythrocebus patas ... http://sn2000.taxonomy.nl/Main/Index/High/..%5C..%5CClassification%5C94157.htm Allenopithecus - Main - Systema Naturae 2000: Subgenus [Allenopithecus] Details ST:Genus Allenopithecus Ref=(o)Grzimek,1974 [C. (A.) nigroviridis] Pocock Details SN:Allenopithecus nigroviridis Ref=(o ... http://www.ubio.org/SOAPbrowser/index.php?func=list_by_package&pkg_id=4 TNS Browser: Allenopithecus nigroviridis (Pocock, 1907). Allied Rock Wallabies Allied Rock Wallaby Allocèbe Allocebus Petter-Rousseaux and Petter, 1967. ... http://www.animalomnibus.com/primates.htm Primates - Order Primates: Allen's Swamp Monkeys - Genus Allenopithecus: Allen's Swamp Monkey - Allenopithecus nigroviridis: Animal Diversity Web. Baboons - Genus Papio: All Baboons, incl. ... http://afmb.cnrs-mrs.fr/CAZY/GH_22.html CAZy - Carbohydrate-Active enZYmes: ...lysozyme, Aix sponsa, 3.2.1.17, -, JC5380, lysozyme C, Allenopithecus nigroviridis, 3.2.1.17, U76949 U76950 U76951, AAB41219.1 AAB41219.1 AAB41219.1, P79687, ... http://www.malariajournal.com/search/results.asp?db=pm&terms=Mauclere_P&field=AU Malaria Journal | Search results Mauclere_P in author: ...and phylogenetic analyses of 16 novel simian T cell leukemia virus type 1 from Africa: close relationship of STLV-1 from Allenopithecus nigroviridis to HTLV-1 ... http://www.nhm.org/research/mammals/holdings/PRIMATES.HTM Mammal Collection Holdings - Order PRIMATES: ...satanas Brazil Para State 4 Pithecia monachus 1 Pithecia pithecia 4 FAMILY CERCOPITHECIDAE SUBFAMILY CERCOPITHECINAE Allenopithecus nigroviridis 1 Cercocebus ... http://www.biologia.uniba.it/primates/Living%20primates.html All rights reserved. Patent pending.: CERCOPITHECIDAE. Old World Monkeys. Allenopithecus nigroviridis Allen's Swamp Monkey. Cercocebus albigena Gray-cheeked Mangabey. Cercocebus ... http://pedant.gsf.de/cgi-bin/wwwfly.pl?Set=Drosophila_melanogaster&Alias=Drosophila_melanogaster&Page=taxrankspecies Drosophila_melanogaster: ...sh-69 alcanivorax borkumensis alcelaphine herpesvirus 1 alicyclobacillus acidocaldarius allactaga elater allenopithecus nigroviridis alligator mississippiensis ... http://eshadow.dcode.org/examples/originalSeqs_PLG.txt human PLG exon 514-634 hg15_dna range=chr6:160968741-160969925 ...: CTGATGTTTTATGTATATTTACATCAATGTGTTTTTCTGGAATGAGGATTCATAACTTCCAT > Allenopithecus nigroviridis gi|27752930|gb|AY192754.1| plasminogen (PLG) gene, exon 6 and ... http://eshadow.dcode.org/examples/originalSeqs_CETP.txt human CETP exon 378-469 hg15_dna range=chr16:56740147-56741178 ...: TCTGGAGGCTGCAGGGTGTCAGGCACGCAGGCCCCTTCCACGTGTTCTCAGCCAGCCCCAGGCGTGGCCT CATCCCAGGGTCCTGGCTGACTGGCCTGACCACCACA > Allenopithecus nigroviridis gi|27752908|gb ... http://www.nap.edu/books/0309069890/html/267.html Nat'l Academies Press, Nutrient Requirements of Nonhuman Primates ...: Pithecia spp. Sakis. Family Cercopithecidae. Subfamily Cercopithecinae. Allenopithecus nigroviridis. Allen’s monkey. Cercocebus spp. Mangabeys. Cercopithecus spp. ... http://www.worldwildlife.org/wildworld/profiles/terrestrial/at/at0110_full.html Terrestrial Ecoregions -- Eastern Congolian swamp forests (AT0110): ...only on the left. Allen's swamp monkey (Allenopithecus nigroviridis) is found on both sides of the Congo River. Near-endemic small ... http://monkey.sbs.ohio-state.edu/CV/mcgraw.htm CURRICULUM VITAE: SUNY at Stony Brook. 1992 The Behavioral Ecology of Allen's Swamp Monkey (Allenopithecus nigroviridis) in Central Zaire. The Douroucouli Foundation. ... http://www.europalex.kataweb.it/Article/0,1605,10898%7C258,00.html [an error occurred while processing this directive] Allenopithecus nigroviridis [an error occurred while processing this directive] 865 Allen's Swamp Monkey, Cercopithèque De Allen Allen's Swamp Monkey, Cercopithèque De Allen Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |