|
|
Antilocapra americana - Mexican Pronghorn, Pronghorn, Antilocapre, Antilope Américaine, BerrendoIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://animaldiversity.ummz.umich.edu/accounts/antilocapra/a._americana$narrative.html ADW: Antilocapra americana: Information: Antilocapra americana (pronghorn). ... Family: Antilocapridae. Genus: Antilocapra. Species: Antilocapra americana. Members of this Species. Geographic Range. ... http://animaldiversity.ummz.umich.edu/site/accounts/pictures/Antilocapra_americana.html ADW: Antilocapra americana: Classification: Antilocapra americana (pronghorn). ... pronghorn Antilocapra americana, pronghorn Antilocapra americana, pronghorn Antilocapra americana. ... http://www.nsrl.ttu.edu/tmot1/antiamer.htm Pronghorn (Antilocapra americana): The Mammals of Texas - Online Edition Pronghorn Order Artiodactyla : Family Antilocapridae : Antilocapra americana (Ord). Description. ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180717 ITIS Standard Report Page: Antilocapra americana: Go to Print Version, Antilocapra americana (Ord, 1815) Taxonomic Serial No.: 180717. ... Species, Antilocapra americana (Ord, 1815) -- Berrendo, pronghorn, ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=202418 ITIS Standard Report Page: Antilocapra americana sonoriensis: Antilocapra americana sonoriensis Goldman, 1945 Taxonomic Serial No.: 202418. ... Species, Antilocapra americana (Ord, 1815) -- Berrendo, pronghorn, ... http://www.nps.gov/wica/Pronghorn.htm Pronghorn: Pronghorn Antelope - Antilocapra americana Another interesting mammal that spends most of its time on the prairie is the pronghorn antelope. ... http://www.nps.gov/wica/Abstracts/Abstract-Chambers-Pronghorn.htm Wind Cave National Park Research Abstract: Experience in Propagation of the Pronghorn (Antilocapra americana) Chambers, AP 1920s. Experience in Propagation of the Pronghorn (Antilocapra americana). ... http://www.thefreedictionary.com/Antilocapra%20americana Antilocapra americana definition of Antilocapra americana. What is ...: Definition of Antilocapra americana in the Dictionary and Thesaurus. Antilocapra americana in Free online English dictionary, thesaurus ... http://www.thefreedictionary.com/Antilocapra Antilocapra definition of Antilocapra. What is Antilocapra? ...: American antelope, Antilocapra americana, prongbuck, pronghorn, pronghorn antelope - fleet antelope-like ruminant of western North American plains with small ... http://www.animals-online.be/hoofed_mammals/gaffelhoornigen/pronghorn_antelope.html Pronghorn Antelope (Antilocapra americana): Fact Sheet: Scientific name. Antilocapra americana. English name. Pronghorn Antelope. Nederlandse naam. Gaffelbok. Nom Français. Antilope d'Amérique. Deutsche name. Gabelbock. ... http://wc.pima.edu/Bfiero/tucsonecology/animals/mamm_pron.htm Pronghorn (Antilocapra americana): Pronghorn (Antilocapra americana). DESCRIPTION: Overall tan or reddish-tan, with white on sides, rump, belly, chest, inner legs, cheeks, and lower jaw. ... http://www.faunistik.net/BSWT/MAMMALIA/UNGULATA/ANTILOCAPRIDAE/antilocapra_americana_01.html Antilocapridae: Antilocapra americana - Gabelbock: ...- Merkmale des Gabelbocks - Antilocapra americana (Bestimmungsübungen an Voegeln und Saeugern). Antilocapra americana - Gabelbock. ... http://www.faunistik.net/BSWT/MAMMALIA/UNGULATA/ANTILOCAPRIDAE/antilocapra_americana_im01.html Antilocapridae: Antilocapra americana - Gabelbock: ...- Gabelbock, Antilocapra americana - Image (Bestimmungsübungen an Voegeln und Saeugern). ... http://www.jww.de/artikelbeitrag/artikelbeitrag_12986.html JAGEN WELTWEIT: Gabelhornantilope <i>Antilocapra americana</i> ...: ...- Praxistipps, - Trense. Gabelhornantilope Antilocapra americana (Ord, 1815). English: Pronghorn; French: Antilocapre americaine; Apache ... http://www.ultimateungulate.com/Artiodactyla/Antilocapra_americana.html Pronghorn: Antilocapra americana. Pronghorn. Taxonomy Antilocapra americana [Ord, 1815]. Citation: In Guthrie, New Geogr., Hist. Coml. ... http://ecos.fws.gov/SpeciesProfile?spcode=A009 Species Profile for Sonoran pronghorn: Link to FWS Home Page. Pronghorn, Sonoran Antilocapra americana sonoriensis Family: Antilocapridae Group: Mammals Current Status: Endangered (see below). ... http://ecos.fws.gov/SpeciesProfile?spcode=A04M Species Profile for Peninsular pronghorn: Link to FWS Home Page. Pronghorn, peninsular Antilocapra americana peninsularis Family: Antilocapridae Group: Mammals Current Status: Endangered (see below). ... http://www.scz.org/animals/p/prnghrn.html Pronghorn - Antilocapra americana: © Sedgwick County Zoo, credit: Dean Foy. Pronghorn. Antilocapra americana. Physical Characteristics. They are not true antelope. They ... http://www.scz.org/animals/p/prnghrn2.html Pronghorn - Antilocapra americana: Select a Mammal. ... http://www.funet.fi/pub/sci/bio/life/mammalia/artiodactyla/antilocapridae/antilocapra/ Antilocapra: Sonora). See [About maps]. Antilocapra americana (Ord, 1815) americana (Ord, 1815); in Guthrie, A New Geogr., Hist. Compl. Grammar ... http://www.uaf.edu/museum/mammal/Hayward/0170.htm Antilocapra americana: Antilocapra americana. Return to index page. http://nasa.utep.edu/chih/theland/animals/mammals/anam.htm Antilocapra americana image 1: Pronghorn Antilocapra americana. Antilocapra americana, male. Photographer: Gerald and Buff Corsi. Copyright © 1999 California Academy of Sciences. ... http://nasa.utep.edu/chih/theland/animals/mammals/antilamer.htm Pronghorn: Pronghorn. Antilocapra americana. pronghorn thumbnail. Context. Kingdom: Animalia Phylum: Chordata Subphylum: Vertebrata Class: Mammalia ... http://www.forestryimages.org/browse/subimages.cfm?sub=9623 pronghorn antelope: Antilocapra americana (Artiodactyla ...: ...pronghorn antelope, Wildlife: Mammals. Mammalia > Artiodactyla > Antilocapridae > Antilocapra americana, Synonym(s): American Antelope. ... http://www.forestryimages.org/browse/detail.cfm?imgnum=1428081 pronghorn antelope, Antilocapridae: Antilocapra americana N/A ...: ...pronghorn antelope, Antilocapridae: Antilocapra americana N/A Image Number: 1428081. Subject: pronghorn antelope. ... http://web4.si.edu/lewisandclark/species.cfm?id=190 Lewis and Clark as Naturalists: Mammal, Antilocapra americana Original name, or synonym, Antilope americana Ord, 1815. pronghorn. Antilocapridae. Chamberlain, South ... http://web4.si.edu/lewisandclark/popup.cfm?type=species&id=871 Antilocapra americana: ...antilocapra skull (Smithsonian Institution). Close Window. http://animalpicturesarchive.com/animal/EngNames/pronghorn.html pronghorn (Antilocapra americana): Animal Pictures Archive's Species Search Start Point. pronghorn (Antilocapra americana) Family: Antilocapridae, Click me to search. ... http://www.ukans.edu/~mammals/antilocapra.html Pronghorns (Family Antilocapridae): Pronghorn Antilocapra americana americana (Ord). Description: The pronghorn can be distinguished by: 1) light cinnamon-brown to tan ... http://asb-biomech.org/onlineabs/NACOB98/197/ LOCOMOTION BIOMECHANICS OF THE PRONGHORN ANTELOPE (ANTILOCAPRA ...: LOCOMOTION BIOMECHANICS OF THE PRONGHORN ANTELOPE (ANTILOCAPRA AMERICANA). Rodger Kram, Sandra Lin, and Heidi Kim Locomotion Lab, Integrative ... http://www.deer.rr.ualberta.ca/library/taxonomy/antilocapra_americana.htm Antilocapra americana: Antilocapra americana. The pronghorn antelope is the sole member of the family Antilocapridae. http://www.fs.fed.us/database/feis/wildlife/mammal/anam/ Antilocapra americana: Index of Species Information. WILDLIFE SPECIES: Antilocapra americana Choose from the following categories of information ... http://www.washington.edu/burkemuseum/mammalogy/mamwash/anam.html Pronghorn: Pronghorn, Antilocapra americana. Order Artiodactyla, Family Antilocapridae. Range in Washington: Yakima Valley, northward. Reintroduced. Habitat: Sagebrush. ... http://www.snomnh.ou.edu/mammalkey/Antilocapra_americana.html Oklahoma Museum of Natural History: Antilocapra americana (Pronghorn). Counties where this species is known to occur are highlighted in blue. ... Search the OMNH Collections for Antilocapra americana. http://www.wordiq.com/definition/Pronghorn Definition of Pronghorn - wordIQ Dictionary & Encyclopedia: Class: Mammalia. Order: Artiodactyla. Family: Antilocapridae. Genus: Antilocapra. Species: americana. Binomial name. Antilocapra americana (Ord, 1815). ... http://intron.bic.nus.edu.sg/chk/gbmam.out Seq ID=LOCUS AALMTCYTOB 307 bp DNA MAM 24-MAR-2000 ORGANISM ...: ...- ... 0 ===== Seq ID=LOCUS AAU03038 1483 bp DNA MAM 13-JAN-1995 ORGANISM Antilocapra americana Eukaryota; Metazoa ... http://search.looksmart.com/p/browse/us1/us317914/us146762/us217721/us10207933/us1177125/ LookSmart - Directory - Guides to Pronghorn Antelope: Animal Diversity Web - Pronghorn Antelope Shares natural history data and photographs of Antilocapra americana, which is not an antelope at all. ... http://www.rhrwildlife.com/theanimals/p/pronghorn/ Rolling Hills Refuge - Wildlife Conservation Center: PRONGHORN (Antilocapra americana). ... Antilocapra americana mexicana - the Mexican pronghorn - found in the Mexican provinces of Chihuahua and Coahuila; ... http://computing-dictionary.thefreedictionary.com/Antilocapra+americana Antilocapra americana definition of Antilocapra americana in ...: Computer term of Antilocapra americana in the Computing Dictionary and Thesaurus. Antilocapra americana in Free online English general ... http://borealie.org/galerie/galerie2.php?page=galerie2&aff=photo&photo=536 Galerie de photos: ...- Galerie de photos. Toutes les photos Faune Flore Soins Autres Nouvelles photos, Antilocapra americana Antilope d'Amérique/Pronghorn. http://en.mimi.hu/animals/pronghorn.html Pronghorn - MiMi: Pronghorned Antelope Antilocapra americana Endangered Once roaming the prairies in numbers rivaling the bison, the pronghorn sheep is now restricted, in Canada ... http://www.fwp.state.mt.us/fieldguide/speciesDetail.aspx?elcode=AMALD01010 Pronghorn Detailed Information - Montana Animal Field Guide: Antilocapra americana Pronghorn (Antelope), In Bunchgrass. Pronghorn Antilocapra americana (Antilocapridae) Global Rank: G5 State Rank: S5 Agency Status USFWS ... http://forest.mtu.edu/students/ebwright/greatlakesmammals/pronghorn.html pronghorn: Antilocapra americana - Pronghorn Distinguishing Characteristics: Physical: antlers one main beam with one little point usually ... http://www.omne-vivum.com/b/3585.htm genus Antilocapra- -: T" "Antilocapra americana species: Antilocapra americana. ... http://www.fw.vt.edu/fishex/nmex_main/species/050584.htm BISON Species Account 050584: 050584 Sonoran Pronghorn Antilocapra americana sonoriensis (AZ). ... Authority, Goldman, 1945. Scientific Name, Antilocapra americana sonoriensis (AZ). ... http://www.fw.vt.edu/fishex/nmex_main/species/050583.htm BISON Species Account 050583: 050583 Chihuahuan Pronghorn Antilocapra americana mexicana (NM,AZ). ... Authority, Merriam, 1901. Scientific Name, Antilocapra americana mexicana (NM,AZ). ... http://www.stockphotography.co.uk/Store/App/Zoom.asp?ProdID=8538 Pronghorn, Antilocapra americana, Pocatello Zoo, Idaho: Pronghorn, Antilocapra americana, Pocatello Zoo, Idaho. add to cart. Category: Animals/Natural History/Misc. Place Taken: Idaho/USA ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=Antilocapra+americana+%5Bgbmam%5D Codon usage table: Antilocapra americana [gbmam]: 1 CDS's (265 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 15.1( 4) UCU 3.8( 1 ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=mitochondrion+Antilocapra+americana+%5Bgbmam%5D Codon usage table: ...mitochondrion Antilocapra americana [gbmam]: 3 CDS's (988 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 12.1 ... http://www.infochembio.ethz.ch/links/zool_saeuget_antilope.html Antilopen: Säugetiere: Gabelbock (Antilocapra americana) - Abbildungen. Gabelbock (Antilocapra americana) - Text. ... Pronghorn Antelope (Antilocapra americana) - Text and Images. ... http://www.nhm.org/research/mammals/holdings/ARTIODAC.HTM Mammal Collection Holdings - Order ARTIODACTYLA: ...tarandus United States Alaska 16 Rangifer tarandus United States California 1 Rangifer tarandus 3 FAMILY ANTILOCAPRIDAE Antilocapra americana United States ... http://www.rmi-online.com/pages/FHAntelope_Article.html Research Mannikins - Your Hometown Taxidermy Supply Store: There are five Pronghorn subspecies: Antilocapra americana antelflexa, Aa oregona, Aa mexican, Aa peninsularis and Aa sonoriensis, of which two are still hunted ... http://medicine.ucsd.edu/cpa/prong.html Comparative Placentation: Pronghorn Antilocapra americana Order: Artiodactyla Family: Antilocapridae 1) General Zoological Data This single member of the genus is widely distributed ... http://www.moellhausen.de/bild/stiftung/36.htm Möllhausen - Antilocapra americana - Stiftung Preußische ...: ...- Stiftung Preußische Schlösser und Gärten Berlin-Brandenburg (I.2.a.) 36 Antilocapra americana Aquarell 27,2x34 cm bez.ur: Möllhausen Aquarellsammlung 2207. ... http://www.infobiogen.fr/db/genbank/GBfasta/gbmam.seq gb|AJ532906|AAL532906 Alces alces kappa-casein gene, exon 4 ...: TTTACAGTAATAGCCACAGCATTCGTTGGATATGTCCTACC >gb|AJ235314|AAM235314 Antilocapra americana mitochondrial DNA for D-loop. ... http://www.infobiogen.fr/db/index-gcg/GENPEPT_140/gp_om_000.ref AJ532906_1 12/2002 AJ532906 Alces alces Alces alces kappa-casein ...: 2" /db_xref="GI:7322075" WEIGHT 11479 LENGTH 102 ORIGIN Translated using phase 3 >>>>AJ271301_1 12/2002 AJ271301 Antilocapra americana Antilocapra americana ... http://www.statemuseum.arizona.edu/zooarch/hierarchy.asp?tl=Genus_sp&tx=Antilocapra%20americana Browse Hierarchically - Comparative Vertebrate Collections ...: The Stanley J. Olsen and WACC Comparative Vertebrate Collections. Holdings for: Antilocapra americana - pronghorn. Specimen #, Sex, Age, Cranium, Postcrania. ... http://www.blueplanetbiomes.org/sonoran_pronghorn_antelope.htm Sonoran Pronghorn Antelope: The Pronghorn – Antilocapra americana (Desert USA)", http://www.desertusa.com/mag99/may/papr/pronghorn.html, (9/8/02). Ingmarsson, Lisa. ... http://www.ine.gob.mx/ueajei/publicaciones/libros/184/bibliogra.html?id_pub=184 Instituto Nacional de EcologÃa: ...- ... Lewis. 1995. Population and habitat viability assessment for the peninsular pronghorn (Antilocapra americana peninsularis). IUCN ... http://www.life.umd.edu/classroom/bsci338m/Image_Archives/Artiodactyla/Artiodactyla.html Mammalogy Image Archives: Artiodactyla: Family Antilocapridae: pronghorn antelope (Antilocapra americana); pronghorn antelope (Antilocapra americana) infant; pronghorn antelope ... http://www4.d25.k12.id.us/phs/biology/pronghorn.html Pronghorn: Scientific name: Antilocapra americana. ... The features of the Antilocapra americana are a lightbrown upperside, white underside, and a white ring around the neck. ... http://bnhm.berkeley.museum/browse/vertebrates_Mammalia_Artiodactyla_Antilocapridae_Antilocapra_all.php?ViewResults=vertebrates_Mammalia_Artiodactyla_Antilocapridae_Antilocapra_all Berkeley Natural History Museums: Genus: Antilocapra view specimens Antilocapra (Unspecified) (33) view specimens Antilocapra americana (pronghorn) (29) view specimens Antilocapra americana ... http://www.enature.com/fieldguide/showRguide.asp?rguideID=715&speciesID=4071 Pronghorn, eNature.com: Pronghorn(Antilocapra americana), Pronghorns eNature.com is a free searchable nature and wildlife database. site index: select a ... http://www.enature.com/fieldguide/showSpecies_LI.asp?imageID=18726 eNature.com - Nature and Wildlife Field Guides: ...site index: select a section. ... http://www.jesseshuntingpage.com/site/antelope.html Pronghorn Antelope Hunting - Jesse's Hunting & Outdoors (JHO): Pronghorn Antelope Biology. History - Antilocapra americana, which literally means the "American goat-antelope". There are 5 Pronghorn subspecies: ... http://www.birdnature.com/nov1900/antelope.html Birds and Nature: The Prong-horned Antelope: THE PRONG-HORNED ANTELOPE. (Antilocapra Americana.). The antelope family comprises many of the most beautiful and graceful species among horned animals. ... http://bioinfo.hku.hk/db/genpept/GPfasta/gpmam.seq gp|AJ532906|AJ532906_1 Alces alces kappa-casein gene, exon 4 ...: CLFMHVGRGLYYGSYTFLETWNIGVILLFTVMATAFAGYVLP >gp|AJ271301|AJ271301_1 Antilocapra americana partial RNase A gene for pancreatic ribonuclease. ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=1042-7260&volume=032&issue=03&page=0373 PRESUMPTIVE COPPER DEFICIENCY IN HAND-REARED CAPTIVE PRONGHORN ...: Vol. 32, No. 3, pp. 373–378. PRESUMPTIVE COPPER DEFICIENCY IN HAND-REARED CAPTIVE PRONGHORN (ANTILOCAPRA AMERICANA) FAWNS. Michele ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0090-3558&volume=038&issue=04&page=0822 <IT>Parelaphostrongylus tenuis</IT> in Captive Pronghorn Antelope ...: Journal of Wildlife Diseases: Vol. 38, No. 4, pp. 822–825. Parelaphostrongylus tenuis in Captive Pronghorn Antelope (Antilocapra americana) in Nebraska. ... http://livingthings.narod.ru/Clt/Ani/Cho/Mam/Atd/Ant/antp01.htm ÐИР"Живые Ñ?ущеÑ?тва" (http://livingthings.narod.ru ...: 001, Antilocapra americana, Вилорог (Ñ?амец), 339 x 420, 39 KB. 002, Antilocapra americana, Вилорог (Ñ?амец), 301 x 420, 31 KB. ... http://www.sci.uidaho.edu/biosci/labs/byers/publications/ Byers Lab: Publications, Department of Biological Sciences ...: Pronghorn (Antilocapra americana) In: Wild Mammals of North America (G. Feldhammer, Bruce Thompson, and Joseph Chapman, eds.), Johns Hopkins University Press ... http://www.globalhunting.com/index.php3?lang=en&go=game-main&id=103 Global Hunting - Hunting Safaris and Adventures in Africa, Asia ...: Pronghorn lat.: Antilocapra americana. Antilocapra americana , the only species within the family Antilocapridae, is unique in its form. ... http://www.fact-index.com/p/pr/pronghorn.html Pronghorn: The Pronghorn (Antilocapra americana) is the only surviving member of the family Antilocapridae, and the fastest land animal in North America running at speeds ... http://www.vetpathology.org/cgi/content/full/38/5/549 Vet Pathol -- Edwards et al. 38 (5): 549: Pathologists BRIEF COMMUNICATIONS AND CASE REPORTS. Fusobacteriosis in Captive Wild-caught Pronghorns (Antilocapra americana). JF ... http://www.floranimal.ru/pages/animal/v/269.html ВИЛОРОГ: ВИЛОРОГ (Antilocapra americana). Млекопитающие / Парнокопытные / Вилорогие / ВИЛОРОГ ... http://www.herpo.com/trans-pecos/mammals/prong.html pronghorn: PRONGHORN Antilocapra americana. The pronghorn was formerly found over much of Texas, but now is found in limited areas in the Trans ... http://natureali.org/carrizo.htm Carrizo Plain National Monument 23 Feb 2003: Pronghorn. Antilocapra americana. Hwy 58, California Valley , San Luis Obispo County. ... Antilocapra americana. Hwy 58, California Valley , San Luis Obispo County. ... http://genome.jouy.inra.fr/db/gcg/genbank/gb_om.seqcat Aal532906 AJ532906 Alces alces kappa-casein gene, exon 4, isolate ...: 3/2000 307bp Aalmtfraa L48342 Alces alces mitochondrial DNA fragment. 11/2001 401bp Aam235314 AJ235314 Antilocapra americana mitochondrial DNA for D-loop. ... http://www.stockpix.com/stock/travel/usa/colorado/180.htm Pronghorn Stock Photography: Antilocapra americana, Pronghorn Stock Photographs. Stock Photography Copyright 2001 Steven Holt/Stockpix.com. All Rights Reserved. ... http://www.stockpix.com/stock/travel/usa/montana/ Montana Stock Photography: Montana Stock Photography from Stockpix.com. All photographs are copyright Steven Holt, Marilyn Moseley LaMantia or Brenda Moseley/stockpix.com. ... http://www.highbeam.com/library/search.asp?FN=AO&refid=ency_refd&search_thesaurus=on&refid=ency_refd&q=pronghorn HighBeam Research: eLibrary Search: Results: PRONGHORN The Columbia Encyclopedia, Sixth Edition; January 10, 2004 PRONGHORN [ pronghorn] or prongbuck, hoofed herbivorous mammal, Antilocapra americana ... ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/artiodactyla/images/image.mid.artiodactyla.antilocapridae.antilocapra.americana.1.html Image Page, Artiodactyla Antilocapridae Antilocapra: Artiodactyla Antilocapridae Antilocapra. Pronghorn (Antilocapra americana), photo by Bernhard Grzimek. Return to Genus Copyright ... http://www.gpzoo.org/FS%20Pronghorn.htm Black Rhinoceros: The Great Plains Zoo participates in the AZA Species Survival Plan. Web Hosting provided by Knight-Tro Soft. Pronghorn Antilocapra americana. ... http://www.blackwell-synergy.com/links/doi/10.1111/j.1523-1739.2004.00548.x/abs/ The Last Mile: How to Sustain Long-Distance Migration in Mammals ...: ...routes for elk (Cervus elaphus), bison ( Bison bison), and North America's sole surviving endemic ungulate, pronghorn (Antilocapra americana), have already ... http://www.ingenta.com/isis/searching/ExpandTOC/ingenta?issue=pubinfobike://ap/fy/2003/00000026/00000001&index=5 Ingenta: Article Summary -- Phylogeny of ruminants secretory ...: Phylogeny of ruminants secretory ribonuclease gene sequences of pronghorn (Antilocapra americana) Molecular Phylogenetics and Evolution January 2003, vol. ... http://itc.boisestate.edu/mediashowcase/media/munger/home14.htm Mammalogy 14: Mammalogy. Back First page. 1 2 3 4 5 6 7 8 9 10 11 12 13 14. antilocapra americana, antilocapra americana, antilocapra americana. bison, bison, bison. http://www.nationalgeographic.com/wildworld/profiles/photos/na/na0811aS.html Terrestrial Ecoregions -- Northern short grasslands (NA0811): ...grasslands (NA0811) Northern short grasslands. Pronghorn antelope (Antilocapra americana), Montana, United States. Photograph by Gerald ... http://www.bartleby.com/61/54/P0595400.html pronghorn. The American Heritage® Dictionary of the English ...: ...pronghorn or prong·horns A small ruminant mammal (Antilocapra americana) resembling an antelope and having small forked horns, found on western North American ... http://www.britannica.com/eb/article?eu=6223&tocid=0&query=the%20encyclopedia%20americana Americana -- Encyclopædia Britannica: The tree, tall or spreading, has leaves elliptic to egg-shaped in ... >, pronghorn (Antilocapra americana), North American hoofed mammal, the sole living member ... http://www.britannica.com/search?query=Americana&submit=Find&source=MWTAB Search Results for Americana - Encyclopædia Britannica: 4), pronghorn (Antilocapra americana), North American hoofed mammal, the sole living member of the family Antilocapridae (order Artiodactyla), also known as ... http://sea.unep-wcmc.org/isdb/CITES/Taxonomy/country_list.cfm?country=MX&col=99&source=animals&displaylanguage=eng Country Summary Result: Family : ANTILOCAPRIDAE, Antilocapra americana (Ord, 1815) Antilocapra americana CITES Appendix I population Antilocapra americana Merriam, 1901 ssp. mexicana ... http://www.invasive.org/browse/subimages.cfm?sub=9623 [an error occurred while processing this directive] Antilocapra americana [an error occurred while processing this directive] 1677 Mexican Pronghorn, Pronghorn, Antilocapre, Antilope Américaine, Berrendo Mexican Pronghorn, Pronghorn, Antilocapre, Antilope Américaine, Berrendo Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |