|
|
Apomys hylocoetes - Mt. Apo Forest MouseIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=57 ITIS 'Expert(s)' Search results for Guy G. Musser: Apomys abrae (Sanborn, 1952) -- valid. Apomys datae (Meyer, 1899) -- valid. Apomys hylocoetes Mearns, 1905 -- valid. Apomys insignis Mearns, 1905 -- valid. ... http://www.fmnh.org/philippine_mammals/Apomys_hylocoetes.htm Apomys hylocoetes of Philippine Mamillian Fauna: Apomys hylocoetes Mearns, 1905. Proc. US Natl. Mus., 28:456. ©2002 ORDER—RODENTIA FAMILY—Muridae. COMMON NAME— Mindanao mossy forest mouse. ... http://www.fmnh.org/philippine_mammals/Muridae.htm Muridae: Muridae (Mice and Rats). Philippine murids are a remarkably diverse group of animals, ranging from small, ground-living shrew-like ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Apodemus uralensis. Apodemus wardi. Apomys abrae. Apomys datae. Apomys hylocoetes. Apomys insignis. Apomys littoralis. Apomys microdon. Apomys musculus. ... http://www.arcbc.org/cgi-bin/abiss.exe/ld?ld=sp_list.htm&tx=MA Species List: Muridae Apomys datae, Luzon montane forest mouse. Muridae Apomys hylocoetes, Mindanao mossy forest mouse. Muridae Apomys insignis, Mindanao montane forest mouse. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: Apodemus speciosus Apodemus sylvaticus Apodemus uralensis Apodemus wardi Apomys abrae Apomys datae Apomys gracilirostris Apomys hylocoetes Apomys insignis ... http://www.ubio.org/SOAPbrowser/index.php?func=list_by_package&pkg_id=4 TNS Browser: Apomys abrae (Sanborn, 1952). Apomys datae (Meyer, 1899). Apomys hylocoetes Mearns, 1905. Apomys insignis Mearns, 1905. Apomys littoralis (Sanborn, 1952). ... http://www.cs.ubc.ca/~jslack/tj/mammalia_A_03-04-16.nh (((((('platypus')'ornithorhynchus')'ornithorhynchidae' ...: ...apodemus speciosus','apodemus sylvaticus','apodemus uralensis','apodemus wardi')'apodemus',('apomys abrae','apomys datae','apomys hylocoetes','apomys insignis ... http://www.bioone.org/bioone/?request=get-document&issn=0022-2372&volume=084&issue=04&page=1443 A NEW SPECIES OF <GENSP>LIMNOMYS</GENSP> (RODENTIA: MURIDAE ...: At the type locality (2,250 m), L. bryophilus was trapped in association with Podogymnura truei, Urogale everetti, Apomys hylocoetes, A. insignis, Batomys ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: AAGGAATTTGTCCAGGGTTCTAAAGATGCTGGAAGTGGCACGGAGCTCTTCAAGCATCCACTGAGACAAG AACTTAACTGCATTCAGGAGACAGTAGGATTGGAGGAGAGTG >Apomys hylocoetes breast cancer protein 1 ... http://www.savci.upol.cz/hlod-2.htm Rodentia - Hlodavci: Sanborn, 1952) - krysa luzonská - Luzon Cordillera Forest Mouse Apomys datae (Meyer, 1899) - krysa - Luzon Montane Forest Mouse Apomys hylocoetes Mearns, 1905 ... http://www.phthiraptera.org/Mammals/Muridae.html [an error occurred while processing this directive] Apomys hylocoetes [an error occurred while processing this directive] 1911 Mt. Apo Forest Mouse Mt. Apo Forest Mouse Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |