|
|
Arvicanthis somalicus - Somali Grass RatIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Arvicanthis blicki. Arvicanthis nairobae. Arvicanthis niloticus. Arvicanthis somalicus. Bandicota bengalensis. Bandicota indica. Bandicota savilei. Batomys dentatus. ... http://www.nih.go.jp/yoken/genebank/MNCb/seq5/MNCb-3207.BLA BLASTN 2.0a2MP-WashU [20-Oct-1996] [Build 22:58:53 Oct 20 1996] ...: 1721 9.9e-72 1 emb|AF004578|ROD AF004578 Arvicanthis sp. cytochrome b (c... 1718 1.3e-71 1 emb|AF004573|ROD AF004573 Arvicanthis somalicus cytochrom... ... http://www.nih.go.jp/yoken/genebank/MNCb/seq5/MNCb-0355.BLA BLASTN 2.0a2MP-WashU [20-Oct-1996] [Build 22:58:53 Oct 20 1996] ...: 1715 1.3e-71 1 RO|AF004573||| AF004573 Arvicanthis somalicus cytochrome ... ... 1677 7.0e-70 1 RO|AF004574||| AF004574 Arvicanthis somalicus cytochrome ... ... http://www.arcbc.org/cgi-bin/abiss.exe/ld?ld=sp_list.htm&tx=MA Species List: Muridae Arvicanthis nairobae, Muridae Arvicanthis niloticus, Muridae Arvicanthis somalicus, Muridae Arvicola sapidus, Muridae Arvicola terrestris, ... http://www.cse.ucsc.edu/research/compbio/yeast-protein-predictions/Q010/Q0105/Q0105.t2k.pa.html a2m2html output for file tmp.a2m: ...gi|18446768|gb|AAL23824.1|_2:377 cytochrome b [Mus pahari]. gi|2921015|gb|AAC04651.1|_2:379 cytochrome b [Arvicanthis somalicus]. ... http://www.blackwell-synergy.com/links/doi/10.1046/j.1439-0469.2001.00169.x/abs/ Three-dimensional geometric morphometrics of Arvicanthis ...: Arvicanthis neumanni (formerly Arvicanthis somalicus, according to Musser and Carleton 1993) was described in Tanzania by Ducroz (1998) and Fadda et al. ... http://www.blackwell-synergy.com/links/doi/10.1111/j.1601-5223.2003.01763.x/abs/ Chromosomal and molecular characterization of Aethomys kaiseri ...: ...(2001) to fall in the same monophyletic clade as A. namaquensis and A. chrysophilus: Arvicanthis niloticus (EMBL-AF004572), Arvicanthis somalicus (EMBL-AF004574 ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...musseri Arvicanthis abyssinicus Arvicanthis blicki Arvicanthis nairobae Arvicanthis niloticus Arvicanthis neumanni Arvicanthis somalicus Bandicota bengalensis ... http://www.ubio.org/SOAPbrowser/index.php?func=list_by_package&pkg_id=4 TNS Browser: Arvicanthis neumanni (Matschie, 1894). Arvicanthis niloticus (Desmarest, 1822). Arvicanthis somalicus Arvicola Lacepede, 1799. Arvicola ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: AGAACAGTGCCTCAGTACTGGAAGCTAACACTGTCAGGTATGCAAGAACGGGATCATTTCGGTGTATGAC >Arvicanthis somalicus breast cancer protein 1 (BRCA1) gene, exon 11 and partial cds ... http://www.savci.upol.cz/hlod-2.htm Rodentia - Hlodavci: 1909 - myš nairobská - Nairobi Grass Rat Arvicanthis niloticus (Desmarest, 1822) - myš nilská - African Grass Rat Arvicanthis somalicus (Matschie, 1894 ... http://sfs.snv.jussieu.fr/bulletin20.html Bulletin de la SFS (N°20, Juin 1998): ...- ... chromosomique par marquage en bandes ont été appliquées pour établir le caryotype de quatre nouvelles espèces (Arvicanthis somalicus, Lemniscomys macculus ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt [an error occurred while processing this directive] Arvicanthis somalicus [an error occurred while processing this directive] 2148 Somali Grass Rat Somali Grass Rat Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |