|
|
Bathyergus suillus - Cape Dune Mole RatIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=584600 ITIS Standard Report Page: Bathyergus: Direct Children: Species, Bathyergus janetta Thomas and Schwann, 1904, Species, Bathyergus suillus (Schreber, 1782), References, Expert(s): Expert: Charles A. Woods, ... http://timeweb.wisdomtools.com/dbt/site34867.html Die Kelders Cave: Arctocepha. pusillus, Atilax paludinosus, Atilax paludinosus, Bathyergus suillus, Bathyergus suillus, Bathyergus suillus, Bathyergus suillus, Bathyergus suillus, ... http://timeweb.wisdomtools.com/dbt/object34867,31,2.html Bathyergus suillus: Objects | Archaeology Index Bathyergus suillus. Description, Cape dune molerat; MNI=2464; NISP= 105974. Site, Die Kelders Cave. Assemblage, Layer 8 fauna. ... http://dictionary.reference.com/search?q=bathyergus%20suillus dictionary.reference.com/search?q=bathyergus%20suillus: Similar pages Dictionary.com/coast ... [Eng.] (b) The force employed in life-saving stations along the seacoast. [US] Coast rat (Zo["o]l.), a South African mammal (Bathyergus suillus), about the ... http://dictionary.reference.com/search?q=coast Biologybase: Mammals of the World: Rodentia 3 (Hystricomorpha): ...go to Mammal Checklist title page. Hystricognathi, Bathyergidae, Bathyergus janetta. Bathyergus suillus. Cryptomys bocagei. Cryptomys damarensis. Cryptomys foxi. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.bathyergidae.bathyergus.html Thumbnails Page, Rodentia Bathyergidae Bathyergus: Rodentia Bathyergidae Bathyergus (Click on thumbnail to view larger image). Dune mole-rat (Bathyergus suillus), photo by John Visser. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/refs/walker.ref-v.html Literature Cited, V: Van der Horst, G. 1972. Seasonal effects on the anatomy and histology of the reproductive tract of the male rodent mole Bathyergus suillus suillus (Schreber). ... http://www.visitsouthafrica.com/National_Parks/Knysna_National_Lake_Area.asp VisitSouthAfrica.com - National Parks - Knysna National Lake Area: Cape dune molerat, Bathyergus suillus. Common molerat, Cryptomys hottentotus. ... Cape dune molerat, Bathyergus suillus. Cape molerat, Georychus capensis. ... http://www.visitsouthafrica.com/National_Parks/Tsitsikamma_np.asp VisitSouthAfrica.com - National Parks - Tsitsikamma National Park: Cercopithecus pygerythrus, Vervet monkey. Lepus saxatilis, Scrub hare. Bathyergus suillus, Cape dune molerat. Cryptomys hottentotus, Common molerat. ... http://www.chez.com/rodent/Bathyergidae/Bathyergidae.html Bathyergidae: Classification. Genus Bathyergus. Bathyergus janetta - Dune mole-rat. Bathyergus suillus - Mole-rat, Cape sand-mole rat -. Genus Cryptomys. Cryptomys bocagei -. ... http://www.das-tierlexikon.de/sandgraeber.htm Sandgräber: ...- ... Die Gattung der Strandgräber (Bathyergus) hat nur eine Art, den eigentlichen Strandgräber oder Kap-Strandgräber (Bathyergus suillus). ... http://www.das-tierlexikon.de/inhalt_s.htm Sackmäuler: ...- ... Selevinia betpakdalaensis. - Sandgräber. - Bathyergidae. - Bathyergus. - Bathyergus suillus. - Blessmull (Art). - Blessmulle (Gattung). - Cryptomys. - Erdbohrer. ... http://www.knysna-info.co.za/english/content.asp?sectionid=241 South African National Parks: Bontebok - Damaliscus dorcas dorcas Bushbuck - Tragelaphus scriptus Scrub hare - Lepus saxatilis Cape dune molerat - Bathyergus suillus Common molerat ... http://www.savci.upol.cz/hlod-5.htm Rodentia - Hlodavci: Bathyergidae) - Mole Rats, Blesmoles: Bathyergus janetta Thomas & Schwann, 1904 - rypoÅ¡ pÃseÄ?ný - Namaqua Dune Mole Rat Bathyergus suillus (Schreber, 1782 ... http://www.tierseiten.com/nagetiere/nagetieresystematik.html Systematik der Nagetiere: ...- ... Bathyergoidea (Sandgräberartige) Familie: Bathyergidae (Sandgräber) Gattung: Bathyergus (Strandgräber) Art: Bathyergus suillus (Kap-Strandgräber) Gattung ... http://www.botany.uwc.ac.za/eeru/cfnr/cfnr.htm the CFNR: ...melanotis), small mammals include the Cape grey mongoose (Galerella pulverulentus), Cape hare (Lepus capensis), Cape dune mole rat (Bathyergus suillus) and at ... http://www.emporia.edu/biosci/msl/rodent.htm MSL, Order Rodentia: Posterolateral view. J Visser Bathyergus suillus - Mole-rat; Cape sand-mole - S Africa; 66 Ventral view, Capetown, South Africa. J ... http://www.hyperdictionary.com/dictionary/coast COAST - Meaning and Definition of the Word: ...[U. S.] {Coast rat} (Zo["o]l.), a South African mammal ({Bathyergus suillus}), about the size of a rabbit, remarkable for its extensive burrows; -- called also ... http://www.lirmm.fr/~vberry/COURS/IRD/PHYLO/2004/29-sequences ID ALIGN_000004; DNA; 1244 symbols (29 sequences) XX AC ...: Trichys fasciculata SO 20 Coendou AJ224664 Coendou melanurus SO 21 Allactaga AJ224661 Allactaga elater SO 22 Bathyergus AJ238384 Bathyergus suillus SO 23 ... http://www.phthiraptera.org/Mammals/Bathyergidae.html Mammals: Bathyergidae: Bathyergus - Dune Mole Rats. Bathyergus janetta Thomas and Schwann, 1904 - Namaqua Dune Mole Rat; Bathyergus suillus (Schreber, 1782) - Cape Dune Mole Rat ... http://getentry.ddbj.nig.ac.jp/cgi-bin/get_entry.pl?AJ427252 Get Entry: LOCUS BSU427252 1167 bp DNA linear ROD 07-JAN-2004 DEFINITION Bathyergus suillus partial A2AB gene for alpha 2B adrenergic receptor, exon 1. ACCESSION AJ427252 ... http://www.thefreedictionary.com/Coast%20rat Coast rat definition of Coast rat. What is Coast rat? Meaning of ...: ...(Zool.), a South African mammal (Bathyergus suillus), about the size of a rabbit, remarkable for its extensive burrows; - called also sand mole. See also: Coast. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/Dangcavi.html Caviomorphes en danger: Bathyergus janetta, Petit fouisseur, Small Dune Mole-rat. Bathyergus suillus janetta, Thomas and Schwann, 1904. SW South Africa; S Namibia. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: BATHYERGIDAE, Bathyergus Cryptomys Georychus Heliophobius Heterocephalus, Bathyergus janetta Bathyergus suillus Cryptomys anselli Cryptomys bocagei Cryptomys ... http://www.psb.ugent.be/rRNA/ssu/list/Mitochondria.html ssu rRNA Mitochondria: Bufo microscaphus U52708; Mit. Balaeniceps rex AF173569; Mit. Bathyergus suillus M63564; Mit. Balanoglossus carnosus AF051097; Mit. Balearica pavonina U76013; Mit. ... http://www.nfi.org.za/mammals/species%20list.html Transvaal Museum - Mammal Department: ORDER RODENTIA (Rodents), BATHYERGIDAE (Molerats), Bathyergus, suillus, Cape dune molerat. janetta, Namaqua dune molerat. Cryptomys, hottentotus, Common molerat. ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/path/Bathyergidae.html.html ADW: Bathyergidae: Classification: ...dune mole-rats). Species Bathyergus janetta (Namaqua dune mole rat). Species Bathyergus suillus (Cape dune mole rat). Genus Cryptomys ... http://www.nasmus.co.za/MAMMALS/COLLECTI.HTM collection: Aonyx capensis. Atelerix frontalis. Atilax paludinosus. Bathyergus suillus. Top. Cercopithecus aethiops. Chlorotalpa sclateri. Crocidura fuscomurina. Crocidura cyanea. ... http://www.bioone.org/bioone/?request=get-citation-links&doi=10.1043/0269-364X(1986)209%3C0125:TBSABD%3E2.0.CO;2&id=I0003-1569-041-05-1171-DAVIES1&sitename=BIOONE Citation Links: CITATION Davies, KC, Jarvis, JUM The burrow systems and burrowing dynamics of the mole-rats Bathyergus suillus and Cryptomys hottentotus in the fynbos of the ... http://www.bioone.org/bioone/?request=get-document&issn=0022-2372&volume=084&issue=01&page=0278 REPRODUCTIVE BIOLOGY OF A SOLITARY SUBTERRANEAN BATHYERGID RODENT ...: Among solitary bathyergids, Bathyergus suillus (Davies and Jarvis 1986 ) and B. janetta (Jarvis and Bennett 1991 ) were reported to be dimorphic, whereas ... http://www.up.ac.za/academic/zoology/2003/doc/molerats.html `A pair of the social Natal mole rat, Cryptomys hottentotus ...: The rare, solitary Namaqua dune mole rat, Bathyergus janetta'. `The largest mole rat in South Africa: the solitary Cape dune mole rat Bathyergus suillus. ... http://www.up.ac.za/academic/acadorgs/zssa/aardvark/no2_1996/uct.html DEPARTMENT OF ZOOLOGY, UNIVERSITY OF CAPE TOWN: ...in entire colonies of naked mole-rats and Shula Croeser has recently joined us to look at the population dynamics of a solitary mole-rat, Bathyergus suillus. ... http://www.gouritz.com/environment.php?fauna Gouritz Initiative : Environment: The Cape dune molerat Bathyergus suillus, which is neither a true mole nor a rat, is an interesting endemic that feeds on, and caches, the below-ground storage ... http://www.arcbc.org/cgi-bin/abiss.exe/ld?ld=sp_list.htm&tx=MA Species List: Procyonidae Bassariscus sumichrasti, Bathyergidae Bathyergus janetta, Bathyergidae Bathyergus suillus, Muridae Batomys dentatus, Large-toothed hairy-tailed rat. ... http://www.nws-wiesbaden.de/samm030.html Museum Wiesbaden - Naturwissenschaftliche Sammlung: Sammlungen ...: ...- ... Stummelschwanzhörnchen]; Bathyergidae: Bathyergus suillus (Schreber) [Kap-Strandgräber]; Bathyergidae: Georhychus capensis (Pallas) [Kap-Bleßmull]; ... http://www.svf.uib.no/sfu/cape/ChrisCV.htm Chris CV: Henshilwood, CS 1997 Identifying the collector: Evidence for human consumption of the Cape dune mole-rat, Bathyergus suillus, from Blombos Cave, southern ... http://www.ru.ac.za/academic/departments/zooento/Martin/hystrichopsyllidae.html Checklist: South African Hystricopsyllid Fleas (Siphonaptera ...: D. ingens (Rothschild) Typhlopsylla ingens Rothschild 1900: 37. Western Cape (endemic); hosted by Bathyergus suillus . Subfamily: CTENOPHTHALMINAE. ... http://geta.life.uiuc.edu/RDP/data/SubMito/Mito_alpha.B.html SSU Mitochondrial rRNA Alphabetic List -- "B": ...janetta (cape dune mole-rat) -- mitochondrion [1195]····4.4.6.4.4·····Bthe.sui_M·····Bathyergus suillus (dune mole-rat ... http://www.museums.org.za/sam/resource/arch/elandani.htm South African Museum - Elandsfontein Fossil Site: ...et sp. nov., antelope, X. Lagomorpha, Lepus capensis, Cape hare, X. X. Rodentia, Bathyergus suillus, dune mole rat, X. X. Georychus cf. capensis Cape molerat, X. ... http://www.museums.org.za/sam/resources/arch/klipgat.htm South African Museum - Die Kelders Cave: X. X. Lepus saxatilis, scrub hare, X. X. Rodentia (larger species only), Bathyergus suillus, dune molerat, X. X. Georychus cf.. capensis Cape molerat, X. X. ... http://www.kommetjie.co.za/NewsOld.asp?Mode=View&ID=11 Kommetjie Community Website: ...mammal in our area. Apart from ourselves there is the much maligned Cape Dune Molerat, Bathyergus suillus. Along with just about ... http://www.cs.ubc.ca/~jslack/tj/mammalia_A_03-04-16.nh (((((('platypus')'ornithorhynchus')'ornithorhynchidae' ...: ...myoprocta acouchy','myoprocta exilis')'myoprocta')'dasyproctinae')'agoutidae',(('bathyergus janetta','bathyergus suillus')'bathyergus',('cryptomys bocagei ... http://www.museumkoenig.uni-bonn.de/for/dfor_huber_acri.htm Arachnida am Museum Koenig (D): Bathyergolichus zumpti (Lawrence, 1956). 1m 2f, 1n, 4 slides. SOUTH AFRICA. host: Bathyergus suillus. Brennandaria silvestris (Jacot, 1936). 1f, 1 slide. ITALY. ... http://www.saparks.com/SouthAfrica/wilderness/wilderness_main.htm Wilderness National Park - South Africa: Lepus saxatilis. Cape dune molerat. Bathyergus suillus. Common molerat. Cryptomys hottentotus. ... Cape dune molerat. Bathyergus suillus. Cape molerat. Georychus capensis. ... http://dict.die.net/bathyergus%20suillus/ dict.die.net/bathyergus%20suillus/: Similar pages Mammal List ... FC. 2. Chrysochloris asiatica, Cape Golden Mole, UC. 3. Bathyergus suillus, Cape Dune Molerat, C. 4. Hystrix africaeustralis, Porcupine, C. ... http://www.zandvleitrust.org.za/mammal%20list.html rufus the mole rat: MSL, Order Rodentia ... Bathyergus suillus - Mole-rat; Cape sand-mole - S Africa ... GL Twiest. Tamias rufus - Hopi Chipmunk. 1344 Side view, Arches Nat ... ... http://www.cwcbr.co.za/facts/conservation1.htm CONSERVATION: Cape Dune Molerat (Bathyergus suillus), Common Molerat (Cryptomus hottentotus), and Cape Golden Mole (Chrysochloris asiatica) are abundant. ... http://web.uct.ac.za/depts/dri/resrep/resrep97/archae97.html DEPARTMENT OF ARCHAEOLOGY: Identifying the collector: evidence for human consumption of the Cape dune mole-rat, Bathyergus suillus, from Blombos Cave, southern Cape, South Africa. ... http://informatics.bio.umass.edu/instruction/biol548/mammsrch.phtml?family=Bathyergidae UMass Mammalogy Database Search Results: Bathyergus suillus, Rodentia, Bathyergidae, skull: dorsal, Bathyergus suillus, Rodentia, Bathyergidae, skull: dorsal mandible, ventral cranium, ... http://meetings.cshl.org/tgac/tgac/results/02pairwise/mysteryblastxtax.htm Tax BLAST Report: 164 4e-39 Bathyergus suillus (Cape dune mole rat) [mammals] taxid 10172 gi|21665813|emb|CAD20290.1| (AJ427252) alpha 2B adrenergic... ... http://www.gpcr.org/7tm/seq/DR/Q8K1W8.TABDR.html GPCRDB Cross References for Q8K1W8: Description, Alpha 2B adrenergic receptor (Fragment). Gene, A2AB. Organism, Bathyergus suillus (Cape dune mole-rat). Chromosomal location, -. Gene Ontology, QuickGO. ... http://www.gpcr.org/7tm/htmls/entries_org.html GPCRDB GPCR entries: Q863L3 (Q863L3) RHO fragment Bassariscus astutus (ringtail). Q8K1W8 (Q8K1W8) A2AB fragment Bathyergus suillus (Cape dune mole-rat). ... http://www.dolally.com/dictionary/definition.asp?Word=Coast "Coast" Definition from Dolally English Dictionary: ...[Eng.] (b) The force employed in life-saving stations along the seacoast. [US] -- Coast rat (Zoöl.), a South African mammal (Bathyergus suillus), about the ... http://bioinformatics.weizmann.ac.il/databases/embl/align/ds18701.dat Submitter: Michael A. Nedbal Department of Wildlife and Fisheries ...: BATHS, Bathyergus suillus BATHJ, Bathyergus janetta CRYHH, Cryptomys hottentotus hottentotus CRYHN, Cryptomys hottentotus natalensis CRYD, Cryptomys damarensis ... http://eo.wikipedia.org/wiki/Ron%C4%9Duloj RonÄ?uloj - Vikipedio: Heliophobius argentocinereus - rypoÅ¡ stÅ™ÃbÅ™itý genro : batiergo - Bathyergus specio : batiergo porka - Bathyergus suillus - rypoÅ¡ praseÄ?à (pomoÅ™ský ... http://www.webster-dictionary.org/definition/coast Coast - Definition of Coast by Webster-Dictionary.org: Coast rat. (Zool.) a South African mammal (Bathyergus suillus), about the size of a rabbit, remarkable for its extensive burrows; - called also sand mole. ... http://rdp.cme.msu.edu/download/SSU_rRNA/SSU_Mito.alpha (July 31, 1998) MITOCHONDRIAL SMALL SUBUNIT rRNA: ALPHABETICALLY ...: ...astutus (ringtail) -- mitochondrion [1196] Bthe.jan_M Bathyergus janetta (cape dune mole-rat) -- mitochondrion [1195] Bthe.sui_M Bathyergus suillus (dune mole ... http://131.111.44.196/refdata/krefdata.html Reference List : index KKK: Godwin Lab Index No: 5895 Klein, RG, (1991) Size variation in the Cape Dune Molerat (Bathyergus suillus) and Late Quaternary climatic change in the ... http://www.chickest.udel.edu/orthomouse/m273.html BLAST Search Results: 78 2e-12 gb|U40072.1|SSU40072 Sus scrofa leukocyte adhesion molecule... 78 3e-12 emb|AJ238384.1|BSU238384 Bathyergus suillus vWF gene (parti... ... http://www.chickest.udel.edu/orthomouse/m140.html BLAST Search Results: 83 6e-13 emb|AJ251143.1|ABE251143 Abrocoma bennettii partial vWF gen... 83 6e-13 emb|AJ238384.1|BSU238384 Bathyergus suillus vWF gene (parti... ... http://www.blackwell-synergy.com/links/doi/10.1046/j.1365-294X.2004.02099.x/abs/ Phylogeographical patterns of genetic divergence and speciation in ...: Jarvis 1981; Bennett & Jarvis 1988; Jarvis & Bennett 1993), descriptions of African mole-rats date back to the 18th century (for Bathyergus suillus), and since ... http://www.thema-briefmarken.de/260_dugong.html thema-briefmarken.de - dugong: ...- ... Schlinger Salzkrautbilche Seleviniidae Salzkrautbilch Selevinia Selevinia betpakdalaensis Sandgräber Bathyergidae Bathyergus Bathyergus suillus Blessmull (Art ... http://bathyergus.suillus.word.sytes.org/ bathyergus.suillus.word.sytes.org/: Supplemental Result - Similar pages TAXONOMY:5402 ID : 10172 PARENT ID : 10170 RANK : species GC ID ...TAXONOMY:5402 ID : 10172 PARENT ID : 10170 RANK : species GC ID : 1 MGC ID : 2 SCIENTIFIC NAME : Bathyergus suillus GENBANK COMMON NAME : Cape dune mole-rat ... http://bighost.area.ba.cnr.it/srs6bin/wgetz?-e+%5BTAXONOMY:'5402'%5D PNAS -- Klein et al. 101 (16): 5708: The identified mammal species are hare (Lepus sp.), Cape dune molerat (Bathyergus suillus), porcupine (Hystrix africaeaustralis), black-backed jackal (Canis ... http://www.ici.com/icishe/naturelink/indexsp2B.htm ICI - Nature Link Database: Basilarchia astyanax *, Batagur baska, Bathyergus suillus. Batis molitor, Battus philenor, Bauhinia veriegata. Bellis perennis, Beta vulgaris maritima, Betula pendula. ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt AF extant Artiodactyla Bovidae Addax nasomaculatus 4.85 70000.3 60 ...: ...- ... Idiurus zenkeri 2 100 116 AF extant Rodentia Anomaluridae Zenkerella insignis 2.3 200 70 AF extant Rodentia Bathyergidae Bathyergus suillus 2.8 625 60 AF ... http://www.esapubs.org/archive/ecol/E084/093/Mammal_lifehistories_v2.txt order family Genus species mass(g) gestation(mo) newborn(g) ...: 1,2" Rodentia Aplodontidae Aplodontia rufa 687.00 0.98 23.58 1.75 392.52 23.45 72 3.14 1.00 "1,2,6,23" Rodentia Bathyergidae Bathyergus suillus 635.00 2.26 ... http://www.infobiogen.fr/db/embl-align/ds26901.dat ACCESSION NUMBER: DS26901 TITLE: Higher level systematics of ...: GTATAAGGAGGATTTAGTAGTAAATCAAGAATAG AGAGCTTGGTTG00111010100101110001000001101000110000000011001000000110001011111101 10000011010 Bathyergus suillus M63564 GCAAA ... http://slides-www.ucsc.edu/subjects/dbms.acgi$BrRecs?12.94 Record List: Date. Search results: Displaying 3 of 3 records found. V000MUR687 BAB332 AB, Rodentia, Bathyergus suillus. Mole-rat; Cape Sand-mole. ... http://www.environment.gov.za/enviro-info/sote/nsoer/resource/wetland/wilderness_ris.htm Wilderness Lakes Ramsar Information Sheet: Cape dune molerats Bathyergus suillus occur on the coastal fynbos where they are regarded as important in maintaining the plant communities through their ... http://www.bennetyee.org/http_webster.cgi?method=exact&isindex=coast&db=* Hypertext Webster Gateway at BennetYee.org: ...[Eng.] (b) The force employed in life-saving stations along the seacoast. [US]. {Coast rat} (Zo["o]l.), a South African mammal ({Bathyergus suillus}), about the ... http://machaut.uchicago.edu/cgi-bin/WEBSTER.sh?WORD=Coast ARTFL Project: Webster Dictionary, 1913: ...[Eng.] (b) The force employed in lifesaving stations along the seacoast. [US] -- Coast rat (Zoöl.) , a South African mammal ( Bathyergus suillus ), about the ... http://www.mujweb.cz/Veda/traxler/rongul.htm ordo : RONÄœULOJ - Rodentia - hlodavci: ...genro : batiergo - Bathyergus. specio : batiergo porka - Bathyergus suillus - rypoÅ¡ praseÄ?à (pomoÄ?skÅ). genro : heterocefalo - Heterocephalus. ... http://rodentbe.free.fr/nederlands/infos/taxonomie.php3 .::Rodent::.: Suborder Hystricognathi. Family Bathyergidae. Bathyergus. Bathyergus janetta. Bathyergus suillus. Cryptomys. Cryptomys bocagei. Cryptomys damarensis. Cryptomys foxi. ... http://members.tripod.com/rodentvzw/rodentnederlands/Taxonomie/bathyergidae.htm Bathyergidae: Bathyergidae. Bathyergus. Bathyergus janetta. Bathyergus suillus. Cryptomys. Cryptomys bocagei. Cryptomys damarensis. Cryptomys foxi. Cryptomys hottentotus. ... http://members.tripod.com/rodentvzw/rodentnederlands/Taxonomie/Taxonomie.htm Rodentia: Suborder Hystricognathi. Family Bathyergidae. Bathyergus. Bathyergus janetta. Bathyergus suillus. Cryptomys. Cryptomys bocagei. Cryptomys damarensis. Cryptomys foxi. ... http://industry.ebi.ac.uk/~alan/BioWidget/Taxonomy/tax4.data 1 root 1 2759 Eukaryotae 1 42452 unclassified eukaryotes 2759 ...: 10182 10168 Thryonomys 10167 10169 Thryonomys swinderianus 10168 10170 Bathyergus 10167 10171 Bathyergus janetta 10170 10172 Bathyergus suillus 10170 10173 ... http://www.parks-sa.co.za/parks/tsitsikamma/default.html Tsitsikama National Park: Cercopithecus pygerythrus, Vervet monkey. Lepus saxatilis, Scrub hare? Bathyergus suillus, Cape dune molerat. Cryptomys hottentotus, Common molerat. ... http://www.science.uwc.ac.za/physiology/Publications/gvdh_publ.htm [an error occurred while processing this directive] Bathyergus suillus [an error occurred while processing this directive] 2620 Cape Dune Mole Rat Cape Dune Mole Rat Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |