Batomys granti - Luzon Forest Rat, Luzon Hairy-Tailed Rat

IUCN Status: Lower Risk/Least Concern
IUCN Species Profile
ITIS Standard Report Page: Batomys granti: Go to Print Version, Batomys granti Thomas, 1895 Taxonomic Serial No.: 585164. ... Genus, Batomys Thomas, 1895, Species, Batomys granti Thomas, 1895, References, ...
http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=57

ITIS 'Expert(s)' Search results for Guy G. Musser: Batomys Thomas, 1895 -- valid. Batomys dentatus Miller, 1911 -- valid. Batomys granti Thomas, 1895 -- valid. Batomys salomonseni (Sanborn, 1953) -- valid. ...
http://www.fmnh.org/philippine_mammals/Batomys_granti.htm

Batomys granti of Philippine Mamillian Fauna: Batomys granti Thomas, 1895. Ann. Mag. Nat. Hist., ser. 6, 16:162. ©2002 ORDER—RODENTIA FAMILY—Muridae. COMMON NAME—Luzon ...
http://www.fmnh.org/philippine_mammals/SpeciesSearch.htm

Species Search: C Apomys sp. D Apomys sp. E Archboldomys luzonensis Archboldomys sp. A (Archboldomys musseri) Batomys dentatus Batomys granti Batomys salomonseni Batomys sp. ...
http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=mitochondrion+Batomys+granti+%5Bgbrod%5D

Codon usage table: ...mitochondrion Batomys granti [gbrod]: 2 CDS's (761 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 19.7( 15) UCU ...
http://www.arcbc.org/cgi-bin/abiss.exe/spd?tx=MA&spd=11307

Species database search results: Family: Muridae, Luzon hairy-tailed rat. Species: Batomys granti, Cites appendix: IUCN Red Databook Status: lc, Endemicity: NW. Notes ...
http://www.interaktv.com/mammals/Rodentia2myo.html

Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Bandicota indica. Bandicota savilei. Batomys dentatus. Batomys granti. Batomys salomonseni. Berylmys berdmorei. Berylmys bowersi. Berylmys mackenziei. ...
http://www.worldwildlife.org/wildworld/profiles/terrestrial/im/im0302_full.html

Terrestrial Ecoregions -- Luzon tropical pine forests (IM0302): Muridae. Apomys sacobianus. Muridae. Batomys dentatus*. Muridae. Batomys granti. Muridae. Bullimus luzonicus. Muridae. Carpomys melanurus*. Muridae. Carpomys phaeurus*. ...
http://www.worldwildlife.org/wildworld/profiles/terrestrial/im/im0123_full.html

Terrestrial Ecoregions -- Luzon rain forests (IM0123): Muridae. Apomys sacobianus. Muridae. Archboldomys luzonensis*. Muridae. Batomys granti. Muridae. Bullimus luzonicus. Muridae. Chrotomys gonzalesi*. Muridae. ...
http://www.pawb.gov.ph/mammals_distribution.htm

PHILIPPINE MAMMALS AND THEIR DISTRIBUTION: Prov., Luzon, Large-toothed hairy-tailed rat, Batomys dentatus, Endemic, Benguet Prov., Luzon, Luzon hairy-tailed rat, Batomys granti, Endemic, Luzon faunal region, ...
http://www.zo.utexas.edu/research/rbrown/Rafespage/Res.wLarry.html

Northern Luzon Biodiversity Research, Part 1: Central Cordilleras ...: Danny Balete and Larry Heaney photographing yet another rat. Batomys granti from the Cordilleras. Arvin and Gee keying out skinks. ...
http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html

Classification des Rodentiens: ...niloticus Arvicanthis neumanni Arvicanthis somalicus Bandicota bengalensis Bandicota indica Bandicota savilei Batomys dentatus Batomys granti Batomys russatus ...
http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas

Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: AAGCACCCGTTGAGACACGAGCTTAACCATAGTCAGGAGACAACAGAAATGGAAGACAGTGAACTTGATA CTCA >Batomys granti breast cancer protein 1 (BRCA1) gene, exon 11 and partial cds ...
http://dinets.travel.ru/philippines.htm

homepage of Vladimir Dinets-Philippines: Rats of Mount Data: 1-Abditomys latidens, 2-Tryphomys adustus, 3-Apomys datae, 4-Crateromys schadenbergi, 5-Capromys melanurus, 6-Batomys granti, 7-Ploeomys ...
http://www.cs.ubc.ca/~jslack/tj/mammalia_A_03-04-16.nh

(((((('platypus')'ornithorhynchus')'ornithorhynchidae' ...: ...niloticus')'arvicanthis',('bandicota bengalensis','bandicota indica','bandicota savilei')'bandicota',('batomys dentatus','batomys granti','batomys salomonseni ...
http://www.savci.upol.cz/hlod-2.htm

Rodentia - Hlodavci: Batomys dentatus Miller, 1911 - krysa lesní - Large-toothed Hairy-tailed Rat Batomys granti Thomas, 1895 - krysa Grantova - Luzon Hairy-tailed Rat Batomys ...
http://www.phthiraptera.org/Mammals/Muridae.html

Mammals: Muridae: Batomys - Hairy-tailed Rats. Batomys dentatus Miller, 1911 - Large-toothed Hairy-tailed Rat; Batomys granti Thomas, 1895 - Luzon Hairy-tailed Rat; ...
http://www.classicnatureprints.com/pr.Smit%20Mammals/smit.mam4.index.html

Joseph Smit Mammal Prints for Sale (4): Joseph Smit (4) The hand-finished chromolithographs below are cut from Transactions of the Zoological Society of London. Size: 9 x 11 inches. ...
http://www.classicnatureprints.com/pr.Smit%20Mammals/smith.crunomys.html

smith: J. Smit Crunomys fallax. Batomys granti. TZS; date 1883 Lithography: Mintern Brothers. Home.
http://www.blackwell-synergy.com/links/doi/10.1111/j.1095-8312.2003.00274.x/full/

Molecular phylogeny of the endemic Philippine rodent Apomys ...: Outgroup taxa were Batomys granti (Thomas, 1895), Chrotomys gonzalesi (Rickart & Heaney, 1991), Archboldomys luzonensis (Musser, 1982), and Rhynchomys ...
http://www.infobiogen.fr/db/cutg/CUTG/gbrod.spsum

[an error occurred while processing this directive] Batomys granti [an error occurred while processing this directive] 2641
Luzon Forest Rat, Luzon Hairy-Tailed Rat Luzon Forest Rat, Luzon Hairy-Tailed Rat

Home | Search | About


Copyright SpeciesList.com 2003-2009