|
Beamys hindei - Lesser Hamster-Rat, Long-Tailed Pouched RatIUCN Status: VulnerableIUCN Species Profile http://animaldiversity.ummz.umich.edu/site/accounts/specimens/Rodentia_0045.html ADW: Rodentia: Classification: ...agrarius. striped field mouse Apodemus agrarius, striped field mouse Apodemus agrarius, long-tailed pouched rat Beamys hindei. long-tailed ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=mitochondrion+Beamys+hindei+%5Bgbrod%5D Codon usage table: ...mitochondrion Beamys hindei [gbrod]: 2 CDS's (762 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 22.3( 17) UCU ... http://www.fmnh.org/tanzania/eam_rodent.html Eastern Arc Rodents: Beamys hindei – Lesser Pouched Rat Beamys is identified by the gray fur, white belly and distinctive mottled tail that is white on the tip. ... http://www.fmnh.org/tanzania/eam_rodent_swa.html Eastern Arc Rodents: Beamys hindei – Lesser Pouched Rat Beamys ana manyoya ya kijivu, tumbo jeupe na mkia wenye rangi zilizofifia na ambao ni mweupe mwishoni. ... http://www.il-st-acad-sci.org/mammals/mami006e.html CRICETOMYINAE: African giant pouched rat, Cricetomys emini. Genus Beamys. Lesser pouched rat, Beamys hindei. Long-tailed pouched rat, Beamys major. Genus Saccostomus. ... http://www.britannica.com/eb/index?search=Be Encyclopædia Britannica: ...athlete), Beams, Jesse W. (Am. phys.), Beamys (mammal genus), Beamys hindei (mammal): see long-tailed pouched rat, bean (legume), Bean, Alan LaVern (Am. astronaut), ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Phodopus roborovskii. Phodopus sungorus. Tscherskia triton. Cricetomyinae, Beamys hindei. Beamys major. Cricetomys emini. Cricetomys gambianus. Saccostomus campestris. ... http://www.das-tierlexikon.de/hamsterratten.htm Hamsterratten: ...- ... Die Kleine Hamsterratte (Beamys hindei) lebt im Wald in Südkenia. ... Arten: Beamys: Kleine Hamsterratte (Beamys hindei), Beamys major. ... http://www.das-tierlexikon.de/inhalt_h.htm Halbaffen: ...- H. - Halbaffen. - Prosimii. - Hamsterratten. - Cricetomyinae. - Beamys. - Beamys hindei. - Beamys major. - Cricetomys. - Cricetomys emini. - Cricetomys gambianus. ... http://www.animalinfo.org/country/tanzania.htm Animal Info - Tanzania: Large-eared Free-tailed Bat (Otomops martiensseni). Lesser Hamster-rat (Beamys hindei). Lion (Panthera leo). Red Bush Squirrel (Paraxerus palliatus). ... http://www.animalinfo.org/country/kenya.htm Animal Info - Kenya: Large-eared Free-tailed Bat (Otomops martiensseni). Lesser Hamster-rat (Beamys hindei). Lion (Panthera leo). Mouse-tailed Bat Species (Rhinopoma macinnesi). ... http://www.birdlist.org/biodiversity/mammals/allmammals/mammallist4.htm Mammallist4: RODENTIA, Muridae, Tscherskia, triton, Ratlike Hamster, (de Winton, 1899), RODENTIA, Muridae, Beamys, hindei, Long-tailed Pouched Rat, Thomas, 1909, ... http://www.senckenberg.uni-frankfurt.de/private/dkock/kock_eaf.htm Dieter Kock: ...- ... 1995). [Beamys hindei] Beaucournu, JC & Kock, D. (1996): Notes sur les Ischnopsyllinae du Continent Africain, III. Compléments ... http://www.ebd.csic.es/info/pubebd?AN=1995 Buscar publicaciones: ...- ... 1995. Population dynamics, distribution and habitat choice of the lesser pouched rat, Beamys hindei. Journal of Zoology 236:499-512. ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: TAGATGCTGGAAGTGGCACAGAGTGCTTGAAGCATCCATTGAGAGACAAACTCAGCCACATTCAGGAGAC A >Beamys hindei breast cancer protein 1 (BRCA1) gene, partial cds ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: CRITETOMYINAE, Beamys Cricetomys Saccostomus, Beamys hindei Beamys major Cricetomys emini Cricetomys gambianus Saccostomus campestris Saccostomus mearnsi. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/DangMyom.html Myomorphes en danger: IUCN : Vulnérable. Beamys hindei, Rat fouisseur à longue queue, Long-tailed pouched rat, Thomas, 1909. S Kenya and neighboring NE Tanzania. IUCN : Vulnérable. ... http://creaty.net/~rodent/NEWS/picup.html PIKCUP: African pouched rat アフリカオニãƒ?ズミ属2種Cricetomys ケニアホ オブクãƒãƒ?ズミ属1種Beamys hindei ãƒ?ビホオブクãƒãƒ?ズミ属2 ... http://lib.ua.ac.be/AB/a4905.html Academic bibliography for | Academische bibliografie voor Verheyen ...: FitzGibbon CD, Leirs H., Verheyen W.. - Distribution, population dynamics and habitat choice of the lesser pouched rat, Beamys hindei (Rodentia: Cricetomyinae ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/refs/walker.ref-e.html Literature Cited, E: J. Mamm. 51:261-68. ___. 1972. Breeding the long-tailed pouched rat, Beamys hindei, in captivity. J. Mamm. 53:296-302. ___. 1979. Vulpes velox. ... http://members.chello.at/rattengruft/liv/heimtiere/ratte.htm Rattengruft: ...- ... Sie ist eine Einzelgängerin und trifft nur zur Paarungszeit auf Artgenossen. Die Kleine Hamsterratte (Beamys hindei) bevorzugt ebenfalls bewaldete Gebiete. ... http://www.rodent.be/rodentnederlands/Taxonomie/muridae.htm Muridae: Tachyoryctes spalacinus. Tachyoryctes splendens. Subfamilie Cricetomyinae. Beamys. Beamys hindei. Beamys major. Cricetomys. Cricetomys emini. Cricetomys gambianus. ... http://www.rodent.be/rodentfrans/Taxonomie/muridae.htm Muridae: Tachyoryctes spalacinus. Tachyoryctes splendens. Genre Cricetomyinae. Beamys. Beamys hindei. Beamys major. Cricetomys. Cricetomys emini. Cricetomys gambianus. ... http://www.br.fgov.be/cgi-bin/BIODIV/research.pl?res_id=790 Search results for research title: Distribution, population dynamics and habitat choice of the lesser pouched rat, Beamys hindei (Rodentia : Cricetomyinae). Journal of Zoology 236:499-512. ... http://www.savci.upol.cz/hlod-2.htm Rodentia - Hlodavci: PodÄ?eleÄ?: kÅ™eÄ?kokrysy (Cricetomyinae) -: Beamys hindei Thomas, 1909 - krysa dlouhoocasá - Long-tailed Pouched Rat Beamys major Dollman, 1914 - krysa ... http://www.phthiraptera.org/Mammals/Muridae.html Mammals: Muridae: Beamys - Long-tailed Pouched Rats. Beamys hindei Thomas, 1909 - Long-tailed Pouched Rat; Beamys major Dollman, 1914 - Greater Long-tailed Pouched Rat ... http://www.virologia.unimi.it/~prea/rodents/lists/vulnerable.html Family: APLODONTIDAE: Red List:VU C2b (Heaney, L.) Distribution:Philippines. Beamys hindei (Lesser Hamster-rat). Red List:VU A1c (Baillie, J.) Distribution:Kenya, Tanzania. ... http://www.thema-spielzeug.de/9167_h%C3%BCpfm%C3%A4use.html thema-spielzeug.de - hüpfmäuse: ...- ... http://www.igelnothilfe.de/pages/lexikon/maus.htm www.das-tierlexikon.de H Halbaffen Prosimii Hamsterratten Cricetomyinae Beamys Beamys hindei Beamys major ... http://legato.bib.uia.ac.be/acadbib/UA/bib_4905.html Verheyen, Walter: FitzGibbon CD, Leirs H., Verheyen W..- Distribution, population dynamics and habitat choice of the lesser pouched rat, Beamys hindei (Rodentia: Cricetomyinae ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt AF extant Artiodactyla Bovidae Addax nasomaculatus 4.85 70000.3 60 ...: ...- ... Rodentia Muridae Arvicanthis niloticus 2.14 138.8 128 AF extant Rodentia Muridae Beamys major -999 -999 -999 AF extant Rodentia Muridae Beamys hindei 1.88 75.8 ... http://www.esapubs.org/archive/ecol/E084/093/Mammal_lifehistories_v2.txt order family Genus species mass(g) gestation(mo) newborn(g) ...: 999.00 "1,2" Rodentia Muridae Bandicota bengalensis 166.67 0.64 4.43 0.97 22.90 2.60 -999 7.96 5.90 "1,2,16,23" Rodentia Muridae Beamys hindei 101.67 0.83 3.20 ... http://12.183.10.150/misspell.htm Pathology Informatics, Inc., Orthography Page: Battrachocottus nicolskii => Batrachocottus nikolskii => fat sculpin; Beamys hinde => Beamys hindei => long-tailed pouched rat; beet ... http://www.zmuc.dk/commonweb/research/biodata_sources_mammals.htm Sources for compilation of Africa databases: mammals: 1995. Distribution, population dynamics and habitat use of the lesser pouched rat, Beamys hindei. Journal of Zoology, London 236:499-512. ... http://bioinfo.hku.hk/db/cutg/gbrod.spsum Acomys cahirinus: 2 1 12 8 4 1 4 2 7 11 3 1 6 3 12 2 3 13 2 5 16 2 ...: 0 0 0 0 17 2 1 8 8 0 6 5 0 6 1 0 4 4 0 7 4 0 0 4 8 7 0 3 3 0 0 4 6 2 0 2 5 0 5 4 5 0 2 0 7 1 1 3 2 4 1 3 9 5 13 9 11 5 0 2 0 4 Mitochondrion Beamys hindei: 2 8 ... http://www.ent.iastate.edu/fleanews/fleanews55.html Flea News 55, January 1998: Beamys hindei, Tanzania, Kisarawe District, Kivu Forest Reserve, 06.48S 38.39E, 27.II.1991, Frontier Tanzania Field team leg. Holotype female, SMF Si.2.2995. ... http://143.129.203.3/evobio/Publicaties/Refereed.htm Refereed journals: CD, Leirs, H. & Verheyen, W. (1995) Distribution, population dynamics and habitat choice of the lesser pouched rat, Beamys hindei (Rodentia: Cricetomyinae). ... http://www.frontierprojects.ac.uk/news-rep.htm Reports of Frontiers Findings: Distribution, population dynamics and habitat choice of the lesser pouched rat, Beamys hindei (Rodentia: Cricetomyinae). Journal of Zoology, 236: 499-512. ... http://ebd.csic.es/datos/pub1995.htm Publicaciones de Personas de la EB Doñana: ...- ... 1995. Population dynamics, distribution and habitat choice of the lesser pouched rat, Beamys hindei. Journal of Zoology 236:499- 512. ... http://www.infobiogen.fr/db/cutg/CUTG/gbrod.spsum Abrothrix jelskii: 1 0 2 1 0 1 0 1 1 4 2 1 1 1 7 0 4 6 0 1 5 0 2 2 ...: 6 0 2 2 2 34 16 0 2 38 2 0 4 10 18 0 10 40 2 2 5 30 0 0 2 20 0 24 10 10 2 18 6 10 2 16 6 18 12 4 2 40 15 32 59 32 2 2 2 0 20 mitochondrion Beamys hindei: 2 8 6 ... http://scilib.univ.kiev.ua/author.php?335390 Сервер періодичних видань::Каталог ...: 25, 1-2 Ñ?. 00045-00049. CD FITZGIBBON, H LEIRS, W VERHEYEN, DISTRIBUTION, POPULATION-DYNAMICS AND HABITATUSE OF THE LESSER POUCHED RAT, BEAMYS HINDEI. ... http://www.journals.uchicago.edu/cgi-bin/resolve?id=doi:10.1086/303400 [an error occurred while processing this directive] Beamys hindei [an error occurred while processing this directive] 2676 Lesser Hamster-Rat, Long-Tailed Pouched Rat Lesser Hamster-Rat, Long-Tailed Pouched Rat Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |