|
Geomys bursarius - Plains Pocket GopherIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.nsrl.ttu.edu/tmot1/geomattw.htm Attwater's Pocket Gopher (Geomys attwateri): Description. This pocket gopher closely resembles the Plains pocket gopher (Geomys bursarius) and Baird’s pocket gopher (G. breviceps). ... http://www.thefreedictionary.com/Geomys%20bursarius Geomys bursarius definition of Geomys bursarius. What is Geomys ...: Definition of Geomys bursarius in the Dictionary and Thesaurus. Geomys bursarius in Free online English dictionary, thesaurus and ... http://www.thefreedictionary.com/Geomys%20pinetis Geomys pinetis definition of Geomys pinetis. What is Geomys ...: Geomys pinetis. Word: Word. Noun, 1. Geomys pinetis - gopher of Alabama and Georgia and Florida southeastern pocket gopher. ... http://animaldiversity.ummz.umich.edu/accounts/geomys/g._bursarius$narrative.html ADW: Geomys bursarius: Information: Geomys bursarius (plains pocket gopher). ... Suborder: Sciurognathi. Family: Geomyidae. Genus: Geomys. Species: Geomys bursarius. Geographic Range. ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/Geomys_bursarius.html ADW: Geomys bursarius: Classification: Geomys bursarius (plains pocket gopher). ... Parent taxa. Genus Geomys (eastern pocket gophers). information. Species Geomys bursarius (plains pocket gopher). ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180216 ITIS Standard Report Page: Geomys bursarius: Go to Print Version, Geomys bursarius (Shaw, 1800) Taxonomic Serial No.: 180216. ... Species, Geomys bursarius (Shaw, 1800) -- plains pocket gopher, References, ... http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=111 ITIS 'Expert(s)' Search results for James L. Patton: Geomys arenarius Merriam, 1895 -- valid -- desert pocket gopher, Tuza arenera. Geomys bursarius (Shaw, 1800) -- valid -- plains pocket gopher. ... http://www.ukans.edu/~mammals/geomys-burs.html Pocket Gophers (Family Geomyidae): Plains Pocket Gopher Geomys bursarius (Shaw). Color photo by Robert M. Timm. Copyright 1999. All rights reserved. Description: The ... http://www.ukans.edu/~mammals/list.html Mammals of Kansas: Pocket Gophers (Family Geomyidae) Yellow-faced Pocket Gopher Cratogeomys castanops Plains Pocket Gopher Geomys bursarius. Pocket ... http://geomys_bursarius.bluerider.com/wordsearch/geomys_bursarius geomys bursarius - BlueRider.com: ...geomys bursarius - listen | domain availability, Dictionary and Thesaurus entries for: geomys bursarius. Your search results... ... http://www.esajournals.org/esaonline/?request=get-abstract&issn=0012-9658&volume=068&issue=05&page=1306 Geomys Bursarius Burrowing Patterns: Influence of Season and Food ...: Ecology: Vol. 68, No. 5, pp. 1306–1318. Geomys Bursarius Burrowing Patterns: Influence of Season and Food Patch Structure. Douglas C. Andersen. Abstract. ... http://www.esajournals.org/esaonline/?request=get-abstract&issn=0012-9658&volume=017&issue=02&page=0325 Abundance and Digging Rate of Pocket Gophers, Geomys Bursarius: 17, No. 2, pp. 325–327. Abundance and Digging Rate of Pocket Gophers, Geomys Bursarius. Carl O. Mohr, and Wm. P. Mohr. Abstract. See full-text article at JSTOR. ... http://www.bioone.org/bioone/?request=get-abstract&issn=0003-0031&volume=145&issue=02&page=0344 Effects of Plains Pocket Gopher (Geomys bursarius) Disturbances on ...: 145, No. 2, pp. 344–357. Effects of Plains Pocket Gopher (Geomys bursarius) Disturbances on Tallgrass-prairie Plant Community Structure. ... http://www.bioone.org/bioone/?request=get-document&issn=0076-3519&volume=672&issue=01&page=0001 Geomys knoxjonesi: Geomys bursarius major Villa-R. and Hall, 1947 :229. Type locality “8 mi. ... Geomys bursarius knoxjonesi Baker and Genoways, 1975 :1. Type locality “4.1 mi. ... http://www.lter.umn.edu/abstr/ik598.html Publications about GEOMYS BURSARIUS: Cedar Creek Natural History Area. Publications about GEOMYS BURSARIUS. ... http://www.lter.umn.edu/abstr/a1081.html Cedar Creek Natural History Area: Source: Oecologia 72:178-184 (1987). Title: Pocket gophers (Geomys bursarius), vegetation, and soil nitrogen along a successional sere in east central Minnesota. ... http://www.animals-online.be/rodents/goffers/plains_pocket_gopher.html Plains Pocket Gopher (Geomys bursarius): Fact Sheet: Scientific name. Geomys bursarius. English name. ... Geomys bursarius has short fur, which can vary from a pale brown to black, and is usually paler on the underside. ... http://www.snomnh.ou.edu/mammalkey/Geomys_bursarius.html Oklahoma Museum of Natural History: Geomys bursarius (Plains Pocket Gopher). Counties where this ... for this species. Search the OMNH Collections for Geomys bursarius. http://www.snomnh.ou.edu/mammalkey/Components/Maps/Geomys%20bursarius.html Oklahoma Museum of Natural History: Geomys bursarius map. Counties where this species is known to occur are highlighted in blue. http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=Geomys+bursarius+%5Bgbrod%5D Codon usage table: Geomys bursarius [gbrod]: 2 CDS's (752 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 18.6( 14) UCU 10.6( 8) UAU ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=Geomys+bursarius+major+%5Bgbrod%5D Codon usage table: Geomys bursarius major [gbrod]: 1 CDS's (376 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 18.6( 7) UCU 10.6 ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0022-2372&volume=081&issue=01&page=0086 MATCHING THE COLOR OF EXCAVATED SOIL: CRYPTIC COLORATION IN THE ...: 86–96. MATCHING THE COLOR OF EXCAVATED SOIL: CRYPTIC COLORATION IN THE PLAINS POCKET GOPHER (GEOMYS BURSARIUS). James J. Krupa, a and Kenneth N. Geluso b ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0022-3395&volume=086&issue=01&page=0153 <B>Arthropod and Helminth Parasites from the Plains Pocket Gopher ...: 153–156. Arthropod and Helminth Parasites from the Plains Pocket Gopher, Geomys bursarius bursarius from the Hosts’ Northern Boundary Range in Minnesota. ... http://computing-dictionary.thefreedictionary.com/Geomys+bursarius Geomys bursarius definition of Geomys bursarius in computing. What ...: Computer term of Geomys bursarius in the Computing Dictionary and Thesaurus. Geomys bursarius in Free online English general, medical ... http://computing-dictionary.thefreedictionary.com/Geomys+pinetis Geomys pinetis definition of Geomys pinetis. What is Geomys ...: ...encyclopedia - dictionary home page, Dictionaries: General, Computing, Medical, Legal, Encyclopedia, Geomys pinetis. Word: Word. ... http://www.fw.vt.edu/fishex/nmex_main/species/050268.htm BISON Species Account 050268: 050268 Plains Pocket Gopher Geomys bursarius. Biota Information System Of New Mexico BISON. version 1/2000. ... Scientific Name, Geomys bursarius. Taxonomic Order, 13440. ... http://www.fw.vt.edu/fishex/nmex_main/species/050269.htm BISON Species Account 050269: ...following Geomys accounts: Geomys arenarius arenarius (050270), Geomys arenarius brevirostris (050260), Geomys knoxjonesi (050269), and Geomys bursarius (050268 ... http://www.statemuseum.arizona.edu/zooarch/hierarchy.asp?tl=Genus_sp&tx=Geomys%20bursarius Browse Hierarchically - Comparative Vertebrate Collections ...: The Stanley J. Olsen and WACC Comparative Vertebrate Collections. Holdings for: Geomys bursarius - plains pocket gopher. Specimen #, Sex, Age, Cranium, Postcrania. ... http://www.statemuseum.arizona.edu/zooarch/names.asp?tl=Class&tx=Mammalia&br=sci Browse by Name - Comparative Vertebrate Collections ...: Felis rufus - bobcat. Return to Top. Geomys arenarius - Desert Pocket Gopher. Geomys bursarius - plains pocket gopher. Geomys pinetis - Southeastern Pocket Gopher. ... http://www.enature.com/fieldguide/showSpecies_LI.asp?imageID=18958&view=1 eNature.com - Nature and Wildlife Field Guides: Click Here. Voles, Lemmings, Pikas, and Pocket Gophers Family: Pocket Gophers. Plains Pocket Gopher Geomys bursarius. Plains Pocket Gopher © Roger W. Barbour, ... http://www.enature.com/fieldguide/showSpeciesSH.asp?curGroupID=5&shapeID=1037&curPageNum=4&recnum=MA0373&view=2 Plains Pocket Gopher, eNature.com: Plains Pocket Gopher(Geomys bursarius), Pocket Gophers eNature.com is a free searchable nature and wildlife database. ... Plains Pocket Gopher Geomys bursarius, ... http://www.ergo-light.com/ERGO/CGI/prot.cgi?prot=RBME00478&user= Protein Page for RBME00478 from Brucella melitensis 16M (IG-21): ...pirnr|NF00591621, 5.70e-48, 859, 7, alcohol dehydrogenase (EC 1.1.1.1) I, Geomys bursarius, ... tr|Q9Z2M3, 6.27e-44, 773, 7, Alcohol dehydrogenase, Geomys bursarius major, ... http://www.ergo-light.com/ERGO/CGI/prot.cgi?request=show_sps_with_func&user=&func=Alcohol%20dehydrogenase%20(EC%201.1.1.1) External Entries with Function Alcohol dehydrogenase (EC 1.1.1.1): ...- ... tr|Q43690, Vitis vinifera, Alcohol dehydrogenase (EC 1.1.1.1). tr|Q64533, Geomys knoxjonesi x Geomys bursarius major, Alcohol dehydrogenase (EC 1.1.1.1). ... http://www.chez.com/rodent/Geomyidae/Geomyidae.html Geomyidae: Geomys bursarius - Plains pocket gopher - Geomys des plaines - Du Manitoba à l'Indiana, Texas -Shaw -1800. Geomys breviceps - Baird's pocket gopher -. ... http://forest.mtu.edu/students/ebwright/greatlakesmammals/plainspocketgopher.html plainspocketgopher: Geomys bursarius - Plains Pocket Gopher Total length: 235-310 mm Weight: 200-400 g. Distinguishing Characteristics: Physical: back ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.geomyidae.geomys.html Thumbnails Page, Rodentia Geomyidae Geomys: Eastern American pocket gopher (Geomys bursarius), photo from Colorado State University through Richard S. Miller. Pocket gopher ... http://www.floranimal.ru/pages/animal/g/1758.html ГОФЕРВОСТОЧÐ?ЫЙ: РодÑ?твенные виды: ГОФЕРКРОТОВИДÐ?ЫЙ. ГОФЕРВОСТОЧÐ?ЫЙ (Geomys bursarius). Млекопитающие ... http://www.axoplasm.com/research/rodents/ Paul Souders: Archaeological Research: Sympatry-Mapping Studies of ...: Cynomys ludovicianus, black-tailed prairie dog, Sciuridae, 1,2,5. Geomys bursarius, plains pocket gopher, Geomydae, 2,3,4,5,6. Microtus ... http://sevilleta.unm.edu/data/species/mammal/socorro/profile/plains-pocket-gopher.html Sevilleta LTER : Data : Species : Mammal : Plains Pocket Gopher: Data : Species : Mammal : Plains Pocket Gopher - Geomys bursarius. Physical Characteristics. "Identification: Head and body 5 1/2-9in. ... http://sevilleta.unm.edu/data/species/mammal/socorro/ Sevilleta LTER : Data : Species : Mammal : Socorro County: Geomyidae - Pocket Gophers. Botta's Pocket Gopher - Thomomys bottae; Plains Pocket Gopher - Geomys bursarius; Desert Pocket Gopher - Geomys arenarius; ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): TRIBE, FAMILY, SUBFAMILY, SCIENTIFIC-NAME. Sciurognathi, Geomyidae, Geomys arenarius. Geomys bursarius. Geomys personatus. Geomys pinetis. Geomys tropicalis. ... http://www.interaktv.com/mammals/Rodent.html Biologybase: Mammals of the World: Rodentia: Castoridae, Castor canadensis. Castor fiber. Geomyidae, Geomys arenarius. Geomys bursarius. Geomys personatus. Geomys pinetis. Geomys tropicalis. Orthogeomys cavator. ... http://www3.baylor.edu/~Ken_Wilkins/subterrprojects.htm Subterranean Mammals: Thesis: The relationships between population demographics of Geomys bursarius and the variability of its food base. Publications: submitted. Student name: ... http://www.site.uottawa.ca:4321/animals/plainspocketgopher.html plains pocket gopher concept from the Canadian Mammals knowledge ...: Next pocket gopher: northern pocket gopher Up: pocket gopher. plains pocket gopher (Geomys bursarius). ... plains pocket gopher, has scientific name Geomys bursarius, ... http://pedant.gsf.de/cgi-bin/wwwfly.pl?Set=Sulfolobus_solfataricus_P2&Alias=Sulfolobus_solfataricus_P2&Page=taxrankspecies Sulfolobus_solfataricus_P2: ...fragaria vesca francisella tularensis frankia alni fusarium oxysporum fusobacterium nucleatum gallus gallus geomys attwateri geomys bursarius geomys knoxjonesi ... http://pedant.gsf.de/cgi-bin/wwwfly.pl?Set=Brucella_melitensis_16M&Alias=Brucella_melitensis_16M&Page=taxrankspecies Brucella_melitensis_16M: ...ana-18 fremyella diplosiphon fritillaria agrestis galleria mellonella gallus gallus geodia cydonium geomys attwateri geomys bursarius geomys knoxjonesi geomys ... http://www.biotic-regulation.pl.ru/data.htm Biotic Regulation of the Environment: Dataset for A. Makarieva's ...: ...[94]. 25. 23. 0.050 *. Geomys breviceps. [95]. 21. 50. 0.029 *. Geomys bursarius. [96]. 17. 24. 0.065 *. Geomys bursarius. [97]. 15. 122. 0.142 *. Geomys bursarius. [95]. 21. 24. ... http://www.das-tierlexikon.de/taschennager.htm Taschennager: ...- ... Die Flachland-Taschenratte (Geomys bursarius) lebt von der kanadischen Grenze bis Mexiko. ... Arten: Geomys: Flachland-Taschenratte (Geomys bursarius). ... http://www.das-tierlexikon.de/inhalt_t.htm Taschenmäuse: ...- ... Flachland-Taschenratte. - Gebirgs-Taschenratte. - Geomys. - Geomys bursarius. - Hamsterratte. - Nördliche Taschenratte. - Orthogeomys. - Orthogeomys grandis. ... http://bioweb.pasteur.fr/docs/doc-gensoft/bambe/Data/gophers.dna 13 379 # category-list=(3,1,2)* # Geomys personatus ...: TGTCCAACTCATCACTAGACATTGTACTG Geomys bursarius TGAAGTTTACATCTTAATCCTACCCGGATTCGGAATAATTTCCCATATTGTTACCTATTACTCAGGAAAA ... http://www.bsu.edu/web/temorrell/ZOOL_446/Lecture_8.htm Lecture 8 Rodentia: Endangered rodents in Indiana. Plains pocket Gopher (Geomys bursarius). ... Rodent Species of Concern in Indiana. Franklin’s ground squirrel (Geomys bursarius). ... http://www.npwrc.usgs.gov/resource/2000/ambad/results.htm Foods of American Badgers During the Duck Nesting Season: Plains pocket gopher (Geomys bursarius) were in 33% of the 9 adult badgers obtained in Minnesota, which includes the range of this species. ... http://www.npwrc.usgs.gov/resource/2001/foxfood/results.htm Food of Swift Fox: We did, however, detect differences between study areas in frequency of occurrence of plains pocket gophers (Geomys bursarius) and heteromyid rodents in scats. ... http://www.inhs.uiuc.edu/chf/pub/surveyreports/sep-oct95/gopher.html Survey Document #2180: The plains pocket gopher (Geomys bursarius), the only gopher that lives in Illinois, is named for its fur-lined pockets, one under each jawbone, that carry ... http://www.inhs.uiuc.edu/cbd/collections/mammal/ilmammals.html INHS Mammal Collection | IL Mammals: Family Geomyidae: Pocket gophers. Geomys bursarius (Shaw, 1800) - plains pocket gopher. Family Castoridae: Beavers. Castor canadensis Kuhl, 1820 - beaver. ... http://www.highbeam.com/library/search.asp?FN=AO&refid=ency_refd&search_thesaurus=on&refid=ency_refd&q=pocket%20AND%20gopher HighBeam Research: eLibrary Search: Results: ...on serpentine ... and JR Tester. 1987. Pocket gophers (Geomys bursarius), vegetation, and soil nitrogen along a ... 14. A review ... http://www.fhsu.edu/biology/choategradstudents.shtml Fort Hays State University: Central College, Iowa, 1983 MS in Biology, Fort Hays State University, 1985 Thesis topic: "Taxonomy of chromosomal races of Geomys bursarius lutescens Merriam ... http://www.texasreptiles.com/trba/species.html Texas Reptiles: ...arenarius) Attwater's Pocket Gopher - (Geomys attwateri) Baird's Pocket Gopher - (Geomys breviceps) Plains Pocket Gopher - (Geomys bursarius) Jones' Pocket ... http://www.oeb.harvard.edu/bazzaz/Bazzaz/KWBcv.html KWBcv.html: Thesis title ìEffect of plains pocket gopher (Geomys bursarius) small-scale disturbance on the structure and composition of a tallgrass prairie plant community ... http://61.1911encyclopedia.org/P/PO/POCKET_GOPHER.htm POCKET-GOPHER: Thomomys they are smooth. The common pocketgopher, Geomys bursarius, of the Mississippi Valley measures about 8 in. in length, with ... http://www.holoweb.com/cannon/pocket.htm Pocket Gopher: ...mounds that they build up on the surface.". Plains Pocket Gopher(Geomys bursarius). Status. the plains pocket gopher was designated rare ... http://polypedal.berkeley.edu/Library/burrow_ref.html burrow refs: African Wild Life 13: 65-71. Bradley, WG, and MK Yousef. 1975. Thermoregulatory responses in the plains pocket gopher, Geomys bursarius. Comp. Biochem. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/DangSciu.html Sciuromorphes en danger: Geomys bursarius bakeri, Baker's Llano pocket gopher, Frio Pocket Gopher, Geomys texensis bakeri, Arizona, New Mexico, Oklahoma, and Texas, Wilslife : endangered. ... http://www.yourdictionary.net/dir/G4750.html Words beginning with G: ...moth | Geometridae | geometry | geometry teacher | geomorphologic | geomorphological | geomorphology | Geomyidae | Geomys | Geomys bursarius | Geomys pinetis ... http://wildlife.wisc.edu/courses/301/mammals/thumbnail_pages/marmota_images.htm Sorex arcticus: Marmota monax, Woodchuck. Dorsal view. Comparison of Geomys bursarius and Marmota monax. Comparison of Marmota monax and Spermophilus franklinii. ... http://www.mammalsociety.org/statelists/txmammals.html ASM | Mammals of Texas: 382, Unique to TX. Baird's Pocket Gopher, Geomys breviceps, Common, East Texas, 383, Plains Pocket Gopher, Geomys bursarius, Common, Panhandle Plains & Central Texas, 690, ... http://www.mammalsociety.org/statelists/newmexico.html ASM | Mammals of New Mexico: Southern Pocket Gopher, Thomomys umbrinus, ST, CF, Desert Pocket Gopher, Geomys arenarius, GL, DS, 36, Plains Pocket Gopher, Geomys bursarius, GL, 690, ... http://www.nceas.ucsb.edu/~alroy/TimeScale.Apx.html North American Mammalian Time Scale: Appendix: Sorex cudahyensis, Sorex lacustris, Sorex megapalustris, Spermophilus lorisrusselli, Stegomastodon barbouri First appearing: Geomys bursarius (Recent), Geomys ... http://www.cast.uark.edu/cast/geostor/data_available/metadata/PredictedPlainsPocketGopherHabitat.htm SMMS METADATA REPORT: ...literature. This portion of the GAP project produced predicted distribution maps for the Plains Pocket Gopher (Geomys bursarius). ... http://www.uvm.edu/~jdecher/Lecture21.html Lecture 21 - Sciurognathi II: Example: Thomomys bottae b) Geomys bursarius (Plains pocket gopher) - 2 grooves on upper incisor, sandy soils of Great Plains; range touches on W Great Lakes ... http://www.museum.state.il.us/research/faunmap/query/taxalist.html Faunmap Taxa Code List: GEar Geomys arenarius (Desert pocket gopher) GEbu Geomys bursarius (Plains pocket gopher) GEpe Geomys personatus (South Texas pocket gopher) GEpi Geomys ... http://www.museum.state.il.us/exhibits/midewin/mammals.html Plants and Animals - Mammals: The plains pocket gopher (Geomys bursarius) is a prairie species found in medium and fine-textured soils along the Illinois River and east and south of the ... http://www.micro-genomes.mpg.de/cgi-bin/getblast.cgi?pir030305.orfprot.RB2373-fdh.blastp getblast.pl beck@molgen-mpg.de: 79 7e-14 SWISSPROT:ADHA_UROHA P25405 uromastyx hardwickii (indian spiny-t... 79 7e-14 SP_TREMBL:Q64533 Q64533 geomys knoxjonesi x geomys bursarius maj... ... http://www.probe.org/docs/bohlin.html Raymond Bohlin Biographical Information: Bohlin, Raymond G. and Zimmerman, Earl G. 1982. Genic differentiation of two chromosome races of the Geomys bursarius complex. Journal of Mammalogy 63:218-228. ... http://www.phthiraptera.org/Mammals/Geomyidae.html Mammals: Geomyidae: Geomydoecus quadridentatus Price and Emerson, 1971 *. Geomys bursarius (Shaw, 1800) - Plains Pocket Gopher Geomydoecus ewingi Price and Emerson, 1971 *. ... http://www.geocities.com/Athens/Cyprus/4397/szmn/Vertebr/Geomyid.htm Geomyidae collection of SZMN, Novosibirsk, Russia: Elena I. Zholnerovskaya) Catalogue. Genus GEOMYS Rafinedque, 1817 Geomys bursarius Shaw, 1800 - 1 specimen. USA, Minnesota: Isanti ... http://www.cas.unt.edu/~ezim/Publist_98.htm Professional Activities of Earl G. Zimmerman: Zimmerman, EG 1999. Species Account: Plains Pocket Gopher, Geomys bursarius. ... Temporal genetic variation in a population of the pocket gopher, Geomys bursarius. ... http://esa.confex.com/esa/2001/techprogram/paper_3662.htm Spatial analysis of distribution patterns of insects inhabiting ...: The distributions of the Illinois Plains Pocket Gopher, Geomys bursarius illinoensis Komarek and Spencer, and select insect species inhabiting their burrows ... http://agg3333.ifas.ufl.edu/scrub_end.txt Alford, RA 1980. Population structure of Gopherus polyphemus in ...: Amin, OM, Pitts, RM 1996. Moniliformis clarki (Acanthocephala: Moniliformidae) from the pocket gopher, Geomys bursarius missouriensis, in Missouri. ... http://www.doane.edu/Crete/ACADEMIC/new_SCIENCE/BIOLOGY/NEWBiology/Research/VERTEBR3.htm MAMMALS OF NEBRASKA: Plains Pocket Gopher Geomys bursarius lutescens Merriam. Plains Pocket Gopher Geomys bursarius majusculus Swenk. POCKET MICE and KANGAROO RATS: Heteromyidae. ... http://www.feep.net/~roth/geek-humor/net/gopher.txt From mb5199@coewl.cen.uiuc.edu Thu Apr 7 05:51:25 1994 Received ...: Its confused relative, *Geomys bursarius*, the Plains Pocket Gopher, in the family Geomyidae, burrows much of the same territory but unlike (above-ground ... http://www.mnstate.edu/biology/Bulletin2000/news_fac-staff.htm MSUM Biology - Faculty/Staff News: He authored a publication entitled, Arthropod and helminth parasites from the plains pocket gopher, Geomys bursarius bursarius, from the hosts’ northern ... http://www.mnstate.edu/biology/Bulletin2000/retirements.htm MSUM Biology - Retirements: ...active throughout his career and in 2000 had a paper entitled "Arthropod and helminth parasites from the plains pocket gopher, Geomys bursarius bursarius, from ... http://www.geneseo.edu/~doc/cv.html Edwin J. Spicka, Ph.D.: Ectoparasites and other arthropod associates on two subspecies of plains pocket gophers: Geomys bursarius illinoensis and Geomys bursarius missouriensis. ... http://www.wtamu.edu/~rmatlack/Mammalogy/lab2.htm LAB: ...gopher Geomys arenarius Desert pocket gopher Geomys attwateri Attwater's pocket gopher Geomys breviceps Baird's pocket gopher Geomys bursarius Plains pocket ... http://www.nps.gov/badl/exp/mammals.htm Mammals: Northern Pocket Gopher, Thomomys talpoides, Year round, Common. Plains Pocket Gopher, Geomys bursarius, Year round, Status Unknown. Olive ... http://www.utexas.edu/utpress/excerpts/exschmap.html Table of Contents and Excerpt, The Mammals of Texas: ...attwateri; Baird's Pocket Gopher, Geomys breviceps; Plains Pocket Gopher, Geomys bursarius; Jones's Pocket Gopher, Geomys knoxjonesi; ... http://fwie.fw.vt.edu/states/nmex_main/species/050268.htm BISON Species Account 050268: 050268 Plains Pocket Gopher Geomys bursarius. Biota Information System Of New Mexico BISON. version 1/2004. ... Scientific Name, Geomys bursarius. Taxonomic Order, 13440. ... http://www.emporia.edu/biosci/msl/rodent.htm MSL, Order Rodentia: DC Gordon Family GEOMYIDAE - Pocket Gophers. Geomys bursarius - Plains pocket gopher - C North America; 690 Side view, showing feet, 1981. ... http://www.emporia.edu/kas/trans098/trans098.htm TKAS 98 (1995): See Abstract. Short Notes. An Archaeological Record of the Plains Pocket Gopher (Geomys bursarius) in Southwestern Missouri. Larry N. Brown. ... http://saltplains.fws.gov/mammals.html Salt Plains NWR - Mammal List: Gophers, Plains pocket gopher (Geomys bursarius) Common in open and grassy areas. Shrews, Least shrew (Cryptotis parva) Probably common, but not often seen. ... http://digital.library.okstate.edu/OAS/oas_htm_files/v74/p25_29nf.html Proceedings of the Oklahoma Academy of Science: ...member of the superfamily Geomyoidea is Sonntag's (1) citation of an 1888 observation that a single circumvallate papilla occurs in the gopher, Geomys bursarius ... http://eo.wikipedia.org/wiki/Ron%C4%9Duloj [an error occurred while processing this directive] Geomys bursarius [an error occurred while processing this directive] 42588 Plains Pocket Gopher Plains Pocket Gopher Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |