|
Georychus capensis - Cape Mole RatIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=584602 ITIS Standard Report Page: Georychus: Family, Bathyergidae Waterhouse, 1841, Genus, Georychus Illiger, 1811, Direct Children: Species, Georychus capensis (Pallas, 1778), References, Expert(s): ... http://fernkloof.com/species2.mv?Georychus%20capensis Georychus capensis - Cape mole-rat. Kaapse blesmol - Mammals in ...: Georychus capensis. ... Fernkloof Nature Reserve. Georychus capensis. Common name - Cape mole-rat. Kaapse blesmol. Click on the photo for ... http://fernkloof.com/species.mv?12 Erica discolor discolor - - Flowers in Fernkloof Nature Reserve ...: Erica discolor discolor. ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=mitochondrion+Georychus+capensis+%5Bgbrod%5D Codon usage table: ...mitochondrion Georychus capensis [gbrod]: 1 CDS's (228 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 21.9( 5 ... http://www.interaktv.com/mammals/Rodentia3Hystr.html Biologybase: Mammals of the World: Rodentia 3 (Hystricomorpha): Cryptomys ochraceocinereus. Cryptomys zechi. Georychus capensis. Heliophobius argenteocinereus. Heterocephalus glaber. Hystricidae, Atherurus africanus. ... http://www.nfi.org.za/mammals/species%20list.html Transvaal Museum - Mammal Department: Cryptomys, hottentotus, Common molerat. damarensis, Damara molerat. Georychus, capensis, Cape molerat. HYSTRICIDAE (Porcupines), Hystrix, africaeaustralis, Cape porcupine. ... http://www.visitsouthafrica.com/National_Parks/Knysna_National_Lake_Area.asp VisitSouthAfrica.com - National Parks - Knysna National Lake Area: Cape dune molerat, Bathyergus suillus. Cape molerat, Georychus capensis. Common molerat, Cryptomys hottentotus. Cape porcupine, Hystrix africaeaustralis. ... http://www.chez.com/rodent/Bathyergidae/Bathyergidae.html Bathyergidae: Cryptomys zechi -. Genus Georychus. Georychus capensis - Cape mole-rat. Genus Heliophobius. Heliophobius argenteocinereus -. Genus Heterocephalus. ... http://www.knysna-info.co.za/english/content.asp?sectionid=241 South African National Parks: Klipspringer - Oreotragus oreotragus Scrub hare - Lepus saxatilis Cape dune molerat - Bathyergus suillus Cape molerat - Georychus capensis Common molerat ... http://www.floranimal.ru/pages/animal/z/556.html ЗЕМЛЕКОП КÐ?ПСКИЙ: РодÑ?твенные виды: ЗЕМЛЕКОП ГОЛЫЙ; ПЕСКОРОЙ БОЛЬШОЙ. ЗЕМЛЕКОП КÐ?ПСКИЙ (Georychus capensis). ... http://www.glenoakzoo.org/Common%20Name.htm Common Name: 49. STAR-NOSED MOLE. Condylura cristata. Mole-rat. 98. BLESMOL. Georychus capensis. 59. COMMON MOLE-RAT. Cryptomys hottentotus. 58. DAMARA MOLE-RAT. Cryptomys damarensis. ... http://www.glenoakzoo.org/scientific_name.htm Scientific Name: 96. Funambulus pennantii. NORTHERN PALM SQUIRREL. 97. Galea musteloides. CAVY. 98. Georychus capensis. BLESMOL. 99. Gerbillurus paeba. HAIRY-FOOTED GERBIL. 100. Gerbillus. ... http://www.up.ac.za/academic/acadorgs/zssa/journal/v20.html South African Journal of Zoology Vol 20 (1985): S. Afr. J. Zool. 20(1):258-260 Taylor PJ, Jarvis JUM, Crowe TM, and Davies KC. Age determination in the Cape molerat Georychus capensis. S. Afr. J. Zool. ... http://www.up.ac.za/academic/zoology/2003/ncbennett.html Student Help: Published Articles. BENNETT, NC and JARVIS, JUM (1988a). The reproductive biology of the Cape mole-rat, Georychus capensis (Rodentia, Bathyergidae). ... http://www.savci.upol.cz/hlod-5.htm Rodentia - Hlodavci: Togo Mole Rat: (syn. Georhychus (sic) zechi) Georychus capensis (Pallas, 1778) - rypoÅ¡ kapský - Cape Mole Rat: (syn. Mus capensis ... http://www.geocities.com/missouri_rats/species.html Rat Association of Southwest Missouri: Articles: Cape Mole Rat Georychus capensis Up to 180 grams Up to 200 mm in length This rat is actually more of a gopher, and is a common underground mammal found in ... http://www.geocities.com/Yosemite/Trails/6676/tokai.htm Tokai: Porcupine (Hysterix africaeaustralis), Grey Mongoose (Galerella pulverulenta), Rock Dassie (Procavia capensisi) and the Cape Molerat (Georychus capensis). ... http://www.angelfire.com/realm2/lex_exotics/cemolerat.html Cape Mole-rat: Cape Mole-rat. Scientific name: Georychus capensis Size: 17-23cm long Lifespan: 5-8 years Natural range: Cape Province of South Africa ... http://www.emporia.edu/biosci/msl/rodent.htm MSL, Order Rodentia: South Africa, 1977. GC Hickman Georychus capensis - Cape mole-rat - South Africa; 1086 Close-up of head. 1988. J Visser Heterocephalus ... http://www.phthiraptera.org/Mammals/Bathyergidae.html Mammals: Bathyergidae: Cryptomys zechi (Matschie, 1900) - Togo Mole Rat Georychus. Georychus capensis (Pallas, 1778) - Cape Mole Rat Heliophobius. Heliophobius ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&term=Reichman+OJ%5Bau%5D Entrez PubMed: Abstract, Seismic signal transmission between burrows of the Cape mole-rat, Georychus capensis. J Comp Physiol [A]. 1992 Jan;170(1):13-21. ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Link&db=PubMed&dbFrom=PubMed&from_uid=15038991 Entrez PubMed: Abstract, Circadian body temperature rhythms of the solitary cape mole rat Georychus capensis (Bathyergidae). Physiol Behav. 1996 ... http://www.routes.co.za/nature/ecoregions/fynbosmountains.html Routes Travel Info Portal: Fynbos in mountains - Montane fynbos ...: Cape golden mole (Chrysochloris asiatica); Cape molerat (Georychus capensis); Verraux’s mouse (Myomyscus verrauxii); Cape gerbil (Tatera afra). Common mammals. ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/path/Bathyergidae.html.html ADW: Bathyergidae: Classification: ...mole rat). Genus Georychus (Cape mole-rat and blesmole). Species Georychus capensis (Cape mole rat and blesmoles). Genus Heliophobius ... http://www.zandvleitrust.org.za/mammal%20list.html Mammal List: 15. Mus musculus, House Mouse, C. 16. Rattus norvegicus, Brown Rat, C. 17. Georychus capensis, Cape Molerat, UK. 18. Vulpus chama, Cape Fox, UK. 19. ... http://www.fmnh.helsinki.fi/users/haaramo/Metazoa/Deuterostoma/Chordata/Synapsida/Eutheria/Rodentia/Hystricognatha/Bathyergomorpha.htm Bathyergomorpha: Georychinae] (myyrärotat) |-- †Paraheliophobius |-- †Richardus |-- †Gypsorhychus |-- Georychus capensis (valkokuonomyyrä) |-- Heliophobius ... http://www.cbi.tamucc.edu/reu/2002rats.htm Baseline Herpetological Data Collection Efforts in Mendocino ...: Using microsatellite loci designed for H. glaber as well as for two closely related species, Cryptomys mechowi and Georychus capensis, we assessed genetic ... http://exon.bic.nus.edu.sg/~meena/sege/gb130/gbrod3.output 1_BLU03528 DEFINITION Bolomys lasiurus cytochrome b gene, complete ...: 86_GCU18837 DEFINITION Georychus capensis cytochrome c oxidase II gene, mitochondrial gene encoding mitochondrial protein, complete cds. ... http://exon.bic.nus.edu.sg/~meena/sege/gb128/gbrod2.101 50278_BLU03528 Bolomys lasiurus cytochrome b gene, complete cds ...: 50362_GCU18837 Georychus capensis cytochrome c oxidase II gene, mitochondrial geneencoding mitochondrial protein, complete cds.!Organellar!Orgn:Mitochondrion ... http://www.ingenta.com/isis/searching/ExpandTOC/ingenta?issue=pubinfobike://sage/j329/2003/00000018/00000006&index=5 Ingenta: Article Summary -- Circadian Rhythms of Locomotor ...: In the solitary species, Georychus capensis, 9 animals exhibited greater activity during the dark phase of the light cycle, while 2 individuals expressed more ... http://www.bioone.org/bioone/?request=get-document&issn=0022-2372&volume=083&issue=01&page=0153 ACTIVITY PATTERNS IN A SUBTERRANEAN SOCIAL RODENT, <GENSP> ...: 1991 ), the Cape mole rat (Bathyergidae: Georychus capensis—Lovegrove and Muir 1996 ; Lovegrove and Papenfus 1995 ), and the Kalahari mole rat (Bathyergidae ... http://www.bioone.org/bioone/?request=get-document&issn=0022-2372&volume=082&issue=01&page=0201 STRUCTURE AND FUNCTION OF ACCESSORY SEX GLANDS IN THE MALE BLIND ...: The Cape mole rat (Georychus capensis—Bennett and Jarvis 1988 ) and the pocket gopher (Geomys bursaris) are known to possess a prostate, seminal vesicle ... http://www.saparks.com/SouthAfrica/wilderness/wilderness_main.htm Wilderness National Park - South Africa: Cape dune molerat. Bathyergus suillus. Cape molerat. Georychus capensis. Common molerat. Cryptomys hottentotus. Cape porcupine. Hystrix africaeaustralis. Cape mouse. ... http://web.uct.ac.za/depts/fitzpatrick/docs/r548.html Pied Crow: ...including fish, lizards, birds, birds eggs, small mammals (Hottentot Golden Mole Amblysomus hottentotus, Cape Molerat Georychus capensis and Striped Field ... http://web.uct.ac.za/depts/dri/resrep/resrep97/anacel97.html DEPARTMENT OF ANATOMY AND CELL BIOLOGY: Omlin, FX 1997. Optic disc and optic nerve of the blind mole rat (Georychus capensis): a proposed model for naturally occurring reactive gliosis. ... http://www.unep-wcmc.org/sites/wh/draken.html Protected Areas Programme -: ...only protected area in Kwazulu-Natal known to have populations of Sclater’s golden mole Chlorotalpa sclateri (VU), Cape mole rat Georychus capensis, ice rat ... http://www.unep-wcmc.org/protected_areas/data/wh/draken.html Protected Areas Programme -: ...protected area in Kwazulu-Natal known to have populations of the the Sclater’s Golden Mole Chlorotalpa sclateri, Cape Mole Rat Georychus capensis, Ice Rat ... http://www.blackwell-synergy.com/links/doi/10.1046/j.1365-2028.2002.00326.x/abs/ Aspects of the feeding habits and reproductive biology of the ...: ...on gestation periods for different bathyergids, as reported by Jarvis (1985) on H. Glaber, by Bennett & Jarvis (1988a, 1988b) on Georychus capensis and C ... http://eo.wikipedia.org/wiki/Ron%C4%9Duloj RonÄ?uloj - Vikipedio: ...kriptomuso makulita - Cryptomys damarensis - rypoÅ¡ skvrnitý genro : georiÄ¥o - Georychus specio : georiÄ¥o kablanda - Georychus capensis - rypoÅ¡ kapský ... http://www.kousakusha.co.jp/KEC/pages/03-004_jpg.htm ベルトゥーフ『少年絵本ã€?第3å·» / 03-004.jpg: ...sungorus) ï¼»5ï¼½Le souri de furoncle(?) ï¼»6ï¼½ã‚タモグラレミン グ(Ellobius talpinus) ï¼»7]フタイãƒãƒ‡ãƒ?ãƒ?ズミ(Georychus capensis ... http://www.worldwildlife.org/wildworld/profiles/terrestrial/at/at1203_full.html Terrestrial Ecoregions -- Montane fynbos and renosterveld (AT1203): Endemic rodents include the Cape spiny mouse (Acomys subspinosus), Cape golden mole (Chrysochloris asiatica), Cape molerat (Georychus capensis), Verraux’s ... http://www.rodent.be/rodentnederlands/Taxonomie/bathyergidae.htm Bathyergidae: Cryptomys ochraceocinereus. Cryptomys zechi. Georychus. Georychus capensis. Heliophobius. Heliophobius argenteocinereus. Heterocephalus. Heterocephalus glaber. ... http://www.cs.ubc.ca/~jslack/tj/mammalia_A_03-04-16.nh (((((('platypus')'ornithorhynchus')'ornithorhynchidae' ...: ...foxi','cryptomys hottentotus','cryptomys mechowi','cryptomys ochraceocinereus','cryptomys zechi')'cryptomys',('georychus capensis')'georychus',('heliophobius ... http://www.und.ac.za/und/cogen/asmn/asmn2.html ASMN- page 2: LAGOMORHA: Pronolagus crassicaudatus RODENTIA: Dendromus nyikae, Otomys laminatus, Georychus capensis, Malacothrix typica, Otomys sloggetti. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/refs/walker.ref-t.html Literature Cited, T: 294, 4 pp. Taylor, PJ, JUM Jarvis, TM Crowe, and KC Davies. 1985. Age determination in the Cape molerat Georychus capensis. S. Afr. J. Zool. 20:261-67. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/refs/walker.ref-b.html Literature Cited, B: J. Mamm. 69:293-302. ___. 1988b. The reproductive biology of the Cape mole-rat, Georychus capensis (Rodentia, Bathyergidae). J. Zool. 214:95-106. ... http://www.psb.ugent.be/rRNA/ssu/list/Mitochondria.html ssu rRNA Mitochondria: Gavia stellata AF173578; Mit. Gazella thomsoni M86501; Mit. Georychus capensis M63566; Mit. Geomys bursarius U67300; Mit. Geococcyx velox U89212; Mit. ... http://bioinformatics.weizmann.ac.il/databases/embl/align/ds18701.dat Submitter: Michael A. Nedbal Department of Wildlife and Fisheries ...: CRYHH, Cryptomys hottentotus hottentotus CRYHN, Cryptomys hottentotus natalensis CRYD, Cryptomys damarensis GEORY, Georychus capensis HETER, Heterocephalus ... http://parasite.vetmed.ufl.edu/html/est/Pb/031/031PbF05.html National Center for Biotechnology Information (NCBI) welcome to ...: II >gi|2147249|pir||I48140 cytochrome c oxidase II - Cape mole-rat mitochondrion >gi|755292 (U18837) cytochrome c oxidase II [Georychus capensis] Length = 227 ... http://geta.life.uiuc.edu/RDP/data/SubUnal/Unal_alpha.G.html SSU Unaligned rRNA Alphabetic List -- "G": DNA 4489 (Nigerian gerbil) -- None·····None·····Gerc.cap_M·····Georychus capensis (Cape mole-rat ... http://srs.pku.edu.cn/srs7bin/cgi-bin/wgetz?-id+lvNB1EbOmM+%5Bswissprot-AccNumber:P50689%5D+-e Entry Page: 41, Last annotation update) DE Cytochrome c oxidase polypeptide II (EC 1.9.3.1). GN MTCO2 OR COII. OS Georychus capensis (Cape mole-rat). OG Mitochondrion. ... http://srs.sanger.ac.uk/srs5bin/cgi-bin/wgetz?-id+2keC41M_g7t+%5Bswissprot-AccNumber:P50689%5D+-e Entry Page: Description, cytochrome c oxidase polypeptide ii (EC 1.9.3.1). Gene name(s), mtco2 or coii. Organism source, Georychus capensis (Cape mole-rat). ... http://www.bionet.nsc.ru/chromosomes/rodentia/hystricomorpha.htm Elobius talpinus Pallas: Cryptomys mechowi, 40. 80. G, C, AgNOR. Macholan M. et al. , 1993. Cytogenet. Cell Genet., 64: 261-263. Georychus capensis Pallas, 54. -. -. -. Mattey R., 1956. ... http://www.micro-genomes.mpg.de/cgi-bin/getblast.cgi?pir030305.orfprot.RB4417.blastp getblast.pl beck@molgen-mpg.de: 77 3e-13 SP_TREMBLNEW:BAC22582 Bac22582 ornithodoros moubata (soft tick).... 77 3e-13 SWISSPROT:COX2_GEOCP P50689 georychus capensis (cape mole-rat). ... ... http://genome.jgi-psf.org/cgi-bin/dispGeneModel.v4?db=chlre2&tid=158293 Protein Pages: Chlamydomonas reinhardtii (Chlamy): ...genome.jgi-psf.org/cgi-bin/ dispGeneModel.v4?db=chlre2&tid=158293 - 25k - Cached - Similar pages Classification des Rodentiens ... foxi Cryptomys hottentotus Crytomys kafuensis Cryptomys mechowi Cryptomys ochraceocinereus Cryptomys zechi Georychus capensis Heliophobius argenteocinereus ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...foxi Cryptomys hottentotus Crytomys kafuensis Cryptomys mechowi Cryptomys ochraceocinereus Cryptomys zechi Georychus capensis Heliophobius argenteocinereus ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0003-1569&volume=041&issue=05&page=1171 Seismic Signal Use by Fossorial Mammals: ...vibrations have been shown to propagate at least an order of magnitude better than airborne sound between the burrow systems of the mole-rat Georychus capensis ... http://www.surfbirds.com/mb/trips/south-africa-ad-0801-species.html Birdwatching in South Africa - August 2001: CAPE MOLE-RAT Georychus capensis 1 Kirstenbosch Botanical Garden, picked up by Peter Ryan as it was making its burrow and closely inspected in the hand, 25/8 ... http://www.infobiogen.fr/db/embl-align/ds26901.dat ACCESSION NUMBER: DS26901 TITLE: Higher level systematics of ...: ACCTAAGGAGGATTTAGTAGTAAATTAAGAATAG AGAGCTTAGTTG00111010100101110001100001101000110000000010001000000001001011111101 10000000010 Georychus capensis M63566 GCAAA ... http://www.infobiogen.fr/db/cutg/CUTG/gbrod.spsum Abrothrix jelskii: 1 0 2 1 0 1 0 1 1 4 2 1 1 1 7 0 4 6 0 1 5 0 2 2 ...: 23 0 14 4 0 3 1 1 14 6 0 2 20 4 0 1 10 7 0 5 15 3 2 7 11 0 2 5 8 3 8 6 7 0 7 5 5 1 7 4 11 6 1 3 14 14 12 20 15 5 1 0 0 11 mitochondrion Georychus capensis: 1 5 ... http://www.research.up.ac.za/2001/UP_Research_Report/Centres/SOOG/articles.htm UP Research Report: Environmental conditions in burrows of two species of African mole-rat, Georychus capensis and Cryptomys damarensis. Journal of Zoology, 254, pp 101-107. ... http://www.mujweb.cz/Veda/traxler/rongul.htm ordo : RONÄœULOJ - Rodentia - hlodavci: ...genro : georiÄ‘o - Georychus. specio : georiÄ‘o kablanda - Georychus capensis - rypoÅ¡ kapskÅ. genro : heliofobio - Heliophobius. ... http://falcon.tamucc.edu/~ghickman/Citation%20Index.htm Citation Index: Lovegrove BG, Muir A Circadian body temperature rhythms of the solitary cape mole rat Georychus capensis (Bathyergidae) PHYSIOL BEHAV 60: (3) 991-998 SEP 1996. ... http://www.parks-sa.co.za/parks/tsitsikamma/default.html Tsitsikama National Park: Bathyergus suillus, Cape dune molerat. Cryptomys hottentotus, Common molerat. Georychus capensis, Cape molerat. Hystrix africaeaustralis, Cape porcupine. ... http://content.karger.com/ProdukteDB/produkte.asp?Aktion=ShowFulltext&ProduktNr=223831&Ausgabe=224672&ArtikelNr=6653 Karger Publishers: Lovegrove, BG, and ME Papenfus (1993) Circadian activity rhythms in the solitary Cape mole-rat (Georychus capensis: Bathyergidae) with some evidence of ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt AF extant Artiodactyla Bovidae Addax nasomaculatus 4.85 70000.3 60 ...: ...- ... 2.1 126.5 129 AF extant Rodentia Bathyergidae Cryptomys ochraceocinereus 2.3 200 "63, 70" AF extant Rodentia Bathyergidae Georychus capensis 2.38 239.3 "60, 129 ... http://industry.ebi.ac.uk/~alan/BioWidget/Taxonomy/tax4.data 1 root 1 2759 Eukaryotae 1 42452 unclassified eukaryotes 2759 ...: 10162 34837 Proechimys longicaudatus 10162 10163 Proechimys guairae 10162 10167 Bathyergidae 33550 10176 Georychus 10167 10177 Georychus capensis 10176 10178 ... http://rdp.cme.msu.edu/download/SSU_rRNA/SSU_Mito.alpha (July 31, 1998) MITOCHONDRIAL SMALL SUBUNIT rRNA: ALPHABETICALLY ...: DNA 4489 (Nigerian gerbil) -- mitochondrion [1201] Gerc.cap_M Georychus capensis (Cape mole-rat) -- mitochondrion [1431] Girf.cam_M Giraffa camelopardalis ... http://www.journals.uchicago.edu/cgi-bin/resolve?id=doi:10.1086/367940 CR White, Burrowing Mammal BMR: 1985. Nutrition and burrowing energetics of the Cape mole-rat Georychus capensis. Oecologia 66:81 87. First citation in article; Fahlbusch V. 1985. ... http://www.journals.uchicago.edu/cgi-bin/resolve?id=doi:10.1086/344739 RR Zenuto, CD Antinuchi, and C. Busch, Reproductive Energetics in ...: Jarvis. 1988. The reproductive biology of the cape mole-rat, Georychus capensis (Rodentia: Bathyergidae). J Zool (Lond) 214:95 106. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/SYNOM/MAM70SYN.txt PRINTNAME SYNON_NAME ORIG_NM AUTHOR CITATION NOTES Hystricognathi ...: ...zimbitiensis Cryptomys hottentotus zuluensis Cryptomys ochraceocinereus kummi Cryptomys ochraceocinereus lechei Georychus capensis buffonii Georychus capensis ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/TAXON/HYSTRIC.txt ME MYPARENT RORDER NAME TAXON PRINTNAME AUTHOR CITATION COMMON_NM ...: ...^Mus^>. <^Mus capensis^> Pallas, 1778. S South Africa. 15 14 0 capensis SPECIES Georychus capensis (Pallas, 1778). Nova Spec. Quad. Glir. Ord., 76:172. ... http://bioinfo.hku.hk/db/cutg/gbrod.spsum Acomys cahirinus: 2 1 12 8 4 1 4 2 7 11 3 1 6 3 12 2 3 13 2 5 16 2 ...: 23 0 14 4 0 3 1 1 14 6 0 2 20 4 0 1 10 7 0 5 15 3 2 7 11 0 2 5 8 3 8 6 7 0 7 5 5 1 7 4 11 6 1 3 14 14 12 20 15 5 1 0 0 11 Mitochondrion Georychus capensis: 1 5 ... http://www.elsevier.com/cdweb/journals/00319384/viewer.htt?viewtype=keywords&rangeselected=6 Physiology & Behavior.: 227-232. BG Lovegrove, ME Papenfus, Circadian Activity Rhythms in the Solitary Cape Molerat (Georychus capensis: Bathyergidae) With Some Evidence of Splitting ... http://www.elsevier.com/cdweb/journals/03619230/viewer.htt?viewtype=keywords&rangeselected=177 Brain Research Bulletin.: FX Omlin, Optic Disc and Optic Nerve of the Blind Cape Mole-Rat (Georychus capensis): A Proposed Model for Naturally Occurring Reactive Gliosis, Brain Research ... http://www.es.embnet.org/srsbin/cgi-bin/wgetz?-id+01M28Zr+%5Bpir-AccNumber:I48140%5D+-e [an error occurred while processing this directive] Georychus capensis [an error occurred while processing this directive] 9077 Cape Mole Rat Cape Mole Rat Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |