|
|
Heliophobius argenteocinereus - Silvery Mole RatIUCN Status: Lower Risk/Near ThreatenedIUCN Species Profile http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=584603 ITIS Standard Report Page: Heliophobius: Family, Bathyergidae Waterhouse, 1841, Genus, Heliophobius Peters, 1846, Direct Children: Species, Heliophobius argenteocinereus Peters, 1846, References, Expert(s): ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/Heliophobius_argenteocinereus.html ADW: Heliophobius argenteocinereus: Classification: Heliophobius argenteocinereus (silvery mole rat). ... Parent taxa. Genus Heliophobius (silvery mole-rat). Species Heliophobius argenteocinereus (silvery mole rat). ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/Bathyergidae.html ADW: Bathyergidae: Classification: ...capensis (Cape mole rat and blesmoles). Genus Heliophobius (silvery mole-rat). Species Heliophobius argenteocinereus (silvery mole rat). ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=mitochondrion+Heliophobius+argenteocinereus+%5Bgbrod%5D Codon usage table: ...mitochondrion Heliophobius argenteocinereus [gbrod]: 1 CDS's (379 codons) fields: [triplet] [frequency: per thousand] ([number]) ... http://www.uni-essen.de/~bb0054/personal/burda/publiste.htm Publications: H. (in press): Characteristics of the underground ecotope of an Afrotropical solitary bathyergid rodent, the silvery mole-rat (Heliophobius argenteocinereus). ... http://www.uni-essen.de/~bb0054/personal/burda/abstracta.htm Abstracts: Scharff, A., Macholan, M., Zima, J., Burda, H. (2001): A new karyotype of Heliophobius argenteocinereus (Bathyergidae, Rodentia) from Zambia with field notes ... http://www.paru.cas.cz/folia/content.php?volume=5&content=164 Folia Parasitologica - Content of volumes: ...n. (Apicomplexa: Eimeriidae), a new parasite species from subterranean African silvery mole-rat, Heliophobius argenteocinereus Pages: 97-99 Abstract. ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0022-2372&volume=084&issue=01&page=0278 REPRODUCTIVE BIOLOGY OF A SOLITARY SUBTERRANEAN BATHYERGID RODENT ...: 84, No. 1, pp. 278–287. REPRODUCTIVE BIOLOGY OF A SOLITARY SUBTERRANEAN BATHYERGID RODENT, THE SILVERY MOLE-RAT (HELIOPHOBIUS ARGENTEOCINEREUS). ... http://apt.allenpress.com/aptonline/?request=get-toc&issn=0022-2372&volume=084&issue=01 Journal of Mammalogy 84/1: ...[Abstract]. REPRODUCTIVE BIOLOGY OF A SOLITARY SUBTERRANEAN BATHYERGID RODENT, THE SILVERY MOLE-RAT (HELIOPHOBIUS ARGENTEOCINEREUS). ... http://www.bioone.org/bioone/?request=get-abstract&issn=0022-2372&volume=084&issue=01&page=0278 REPRODUCTIVE BIOLOGY OF A SOLITARY SUBTERRANEAN BATHYERGID RODENT ...: 84, No. 1, pp. 278–287. REPRODUCTIVE BIOLOGY OF A SOLITARY SUBTERRANEAN BATHYERGID RODENT, THE SILVERY MOLE-RAT (HELIOPHOBIUS ARGENTEOCINEREUS). ... http://www.bioone.org/bioone/?request=cite-builder&doi=10.1043%2F0022-2372(2003)084%3C0278:RBOASS%3E2.0.CO%3B2 BioOne: Citation Formats: REPRODUCTIVE BIOLOGY OF A SOLITARY ...: Chitaukali, Wilbert N. REPRODUCTIVE BIOLOGY OF A SOLITARY SUBTERRANEAN BATHYERGID RODENT, THE SILVERY MOLE-RAT (HELIOPHOBIUS ARGENTEOCINEREUS) Journal of ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.bathyergidae.heliophobius.html Thumbnails Page, Rodentia Bathyergidae Heliophobius: Sand rat (Heliophobius argenteocinereus), photo from Nyasaland Museum through P. Hanney. Insets: photos from Naturw. Reise nach Mossambique, W. Peters. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.mid.rodentia.bathyergidae.heliophobius.argenteocinereus.1.html Image Page, Rodentia Bathyergidae Heliophobius: Rodentia Bathyergidae Heliophobius. Sand rat (Heliophobius argenteocinereus), photo from Nyasaland Museum through P. Hanney. Insets: photos from Naturw. ... http://www.jcu.cz/vyzkum/ukol.php3?ukol=171 Vyzkumny ukol - podrobne: Ekoetologie soliterniho podzemniho hlodavce, rypose stribriteho (Heliophobius argenteocinereus). Cislo grantoveho programu: GA 206/00/1699 Resitel na JU: Mgr. ... http://www.jcu.cz/vyzkum/vybrane.php3 Vyhledane vyzkumne programy na Jihoceske univerzite: Ekoetologie soliterniho podzemniho hlodavce, rypose stribriteho (Heliophobius argenteocinereus), Mgr. Radim Sumbera, Zoologie. Biologicka fakulta, GA CR, 2000, 2001. ... http://www.iach.cz/knav/autority/196.htm Odevzdané záznamy za rok 2003: BaruÅ¡, Vlastimil:UBO-W: Protospirura muricola (Nematoda) and Inermicapsifer arvicanthidis (Cestoda) in their definitive host silvery mole-rat (Heliophobius argenteocinereus: Rodentia ... http://www.iach.cz/lge/PUBmach.htm Pracovnà skupina genetiky: Scharff A., Macholán M., Zima J., Burda H. (2001) A new karyotype of Heliophobius argenteocinereus (Bathyergidae, Rodentia) from Zambia with field notes on ... http://www.elis.sk/helm/2003_03.htm Psychologia a patopsychologia dietata 1/2002: HELMINTHOLOGIA, 40, 3:147-151, 2003. Helminths parasitizing the silvery mole-rat, Heliophobius argenteocinereus (Rodentia: Bathyergidae) from Malawi. ... http://www.interaktv.com/mammals/Rodentia3Hystr.html Biologybase: Mammals of the World: Rodentia 3 (Hystricomorpha): Cryptomys zechi. Georychus capensis. Heliophobius argenteocinereus. Heterocephalus glaber. Hystricidae, Atherurus africanus. Atherurus macrourus. ... http://www.tierseiten.com/nagetiere/nagetieresystematik.html Systematik der Nagetiere: ...- ... Georhychus (Bleßmulle) Art: Georhychus capensis (Kap-Bleßmull) Gattung: Heliophobius (Erdbohrer) Art: Heliophobius argenteocinereus (Silbergrauer Erdbohrer ... http://www.chez.com/rodent/Bathyergidae/Bathyergidae.html Bathyergidae: Cryptomys zechi -. Genus Georychus. Georychus capensis - Cape mole-rat. Genus Heliophobius. Heliophobius argenteocinereus -. Genus Heterocephalus. ... http://www.nws-wiesbaden.de/samm030.html Museum Wiesbaden - Naturwissenschaftliche Sammlung: Sammlungen ...: ...- ... Bathyergidae: Heliophobius argenteocinereus Peters [Silbergrauer Erdbohrer]; Bovidae: Aepyceros melampus (Lichtenstein) [Impala, Schwarzfersenantilope]; ... http://www.nafcon.dircon.co.uk/rodents_caviomorpha.html CLASSIFICATION OF RODENT SPECIES: CAVIOMORPHA (Cavy-like rodents): ...above ground. The silver mole rat Heliophobius argenteocinereus is solitary, but the others are presumably colonial in nature. Apart ... http://www.saske.sk/~pauwww/helminthologia/issues23_4.htm CONTENS OF RECENT ISSUE: Protospirula muricola (Nematoda) and Inermicapsifer arvicanthidis (Cestoda) in their definitive host silvery mole-rat (Heliophobius argenteocinereus: Rodentia). ... http://www.saske.sk/~pauwww/helminthologia/issues23_3.htm CONTENS OF RECENT ISSUE: HELMINTHOLOGIA, 40, 3:153-160, 2003. Helminths parasitizing the silvery mole-rat, Heliophobius argenteocinereus (Rodentia: Bathyergidae) from Malawi. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/Dangcavi.html Caviomorphes en danger: EC Ghana, WC Togo. IUCN : Risque d’être menacé. Heliophobius argenteocinereus, Grand rat-taupe, Rat-taupe argenté, Silvery Mole-rat, Silky Mole-rat. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: Crytomys kafuensis Cryptomys mechowi Cryptomys ochraceocinereus Cryptomys zechi Georychus capensis Heliophobius argenteocinereus Heterocephalus glaber. ... http://zoo-muzeum.wz.cz/savci.htm Soukrome Zoologicke Muzeum Benjamina Hlivky: Dikobraz obecný, Hystrix cristata. Ä?elist, mandibula. RypoÅ¡ stÅ™ÃbÅ™itý, Heliophobius argenteocinereus, Silvery Mole Rat. Mali. ... http://www.gruen-as.de/2004/15/artikel5.html Schulzoo: ...- ... Die größte Rarität war allerdings die Ankunft eines silbergrauen Erdbohrers (Heliophobius argenteocinereus) mit dem selben Transport. ... http://www.phthiraptera.org/Mammals/Bathyergidae.html Mammals: Bathyergidae: Georychus. Georychus capensis (Pallas, 1778) - Cape Mole Rat Heliophobius. Heliophobius argenteocinereus Peters, 1846 - Silvery Mole Rat Heterocephalus. ... http://www.urbanfischer.de/journals/mammbiol/content/saeug01.htm Mammalian Biology - Table of Contents 2001: ...- ... Scharff, A.; Macholan, M.; Zima, J.; Burda, H.: A new karyotype of Heliophobius argenteocinereus (Bathyergidae, Rodentia) from Zambia with field notes on the ... http://www.fmnh.helsinki.fi/users/haaramo/Metazoa/Deuterostoma/Chordata/Synapsida/Eutheria/Rodentia/Hystricognatha/Bathyergomorpha.htm Bathyergomorpha: Paraheliophobius |-- †Richardus |-- †Gypsorhychus |-- Georychus capensis (valkokuonomyyrä) |-- Heliophobius argenteocinereus (hopeamyyrärotta) |--o ... http://www.up.ac.za/academic/acadorgs/zssa/journal/v8.html Zoologica Africana Vol 8 (1973): Zoologica Africana 8(1):91-100 Jarvis JUM. Activity patterns in the mole-rats Tachyoryctes splendens and Heliophobius argenteocinereus. ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Link&db=PubMed&dbFrom=PubMed&from_uid=12537118 Entrez PubMed: Abstract, Eimeria burdai sp. n. (Apicomplexa: Eimeriidae), a new parasite species from subterranean African silvery mole-rat, Heliophobius argenteocinereus. ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=PureSearch&db=PubMed&details_term=(%22Housing%2C%20Animal%22%5BMeSH%5D%20AND%20rats%5Ball%5D Entrez PubMed: Abstract, Silvery mole-rats ( Heliophobius argenteocinereus, Bathyergidae) change their burrow architecture seasonally. Naturwissenschaften. ... http://www.savci.upol.cz/hlod-5.htm Rodentia - Hlodavci: Rat: (syn. Mus capensis) Heliophobius argenteocinereus Peters, 1846 - rypoÅ¡ stÅ™ÃbÅ™itý - Silvery Mole Rat Heterocephalus glaber ... http://www.vri.cz/news/prilohy/pril174.htm Web of Science General Search Results--Summary: F. (2000): Eimeria burdai sp n. (Apicomplexa : Eimeriidae), a new parasite species from subterranean African silvery mole-rat, Heliophobius argenteocinereus. ... http://exon.bic.nus.edu.sg/~meena/sege/gb130/gbrod3.output 1_BLU03528 DEFINITION Bolomys lasiurus cytochrome b gene, complete ...: 107_HAU87527 DEFINITION Heliophobius argenteocinereus cytochrome-b gene, mitochondrial gene encoding mitochondrial protein, complete cds. ... http://exon.bic.nus.edu.sg/~meena/sege/gb128/gbrod2.101 50278_BLU03528 Bolomys lasiurus cytochrome b gene, complete cds ...: 50383_HAU87527 Heliophobius argenteocinereus cytochrome-b gene, mitochondrial geneencoding mitochondrial protein, complete cds.!Organellar!Orgn:Mitochondrion ... http://www.geocities.com/Paris/8678/mamull3.htm PPL Mamuloj: Bathyergidae kriptomuso @ makulita talpo-rato Cryptomys damarensis heliofobio @ arÄ?ent-griza talpo-rato Heliophobius argenteocinereus heterocefalo @ nuda talpo ... http://www.geocities.com/Paris/8678/mamulcx.htm PPL Mamuloj: Bathyergidae kriptomuso @ makulita talpo-rato Cryptomys damarensis heliofobio @ argxent-griza talpo-rato Heliophobius argenteocinereus heterocefalo @ nuda talpo ... http://www.csets.sk/konf02/program.htm Pozvánka na 29. etologickou konferenci ÄŒSEtS: 13:20. Ema Knotková. Vokalizace rypoÅ¡e stÅ™ÃbÅ™itého (Heliophobius argenteocinereus). Sekce: PÅ™ÃspÄ›vky na volné téma. PÅ™edsedajÃcÃ: Pavel Stopka. 13:40. ... http://www.blackwell-synergy.com/links/doi/10.1046/j.1365-294X.2004.02099.x/enhancedabs/ Phylogeographical patterns of genetic divergence and speciation in ...: Scharff A, Macholan M, Burda H (2001) A new karyotype of Heliophobius argenteocinereus (Baathyergidae, Rodentia) from Zambia with field notes on the species. ... http://www.blackwell-synergy.com/links/doi/10.1046/j.1365-294X.2004.02099.x/abs/ Phylogeographical patterns of genetic divergence and speciation in ...: ...species ranged from a minimum of 4.1 ± 0.19% between B. suillus and B. janetta to 26.4 ± 0.05% between Heterocephalus glaber and Heliophobius argenteocinereus ... http://www.cs.ubc.ca/~jslack/tj/mammalia_A_03-04-16.nh (((((('platypus')'ornithorhynchus')'ornithorhynchidae' ...: ...cryptomys ochraceocinereus','cryptomys zechi')'cryptomys',('georychus capensis')'georychus',('heliophobius argenteocinereus')'heliophobius',('heterocephalus ... http://bioinformatics.weizmann.ac.il/databases/embl/align/ds18701.dat Submitter: Michael A. Nedbal Department of Wildlife and Fisheries ...: ...hottentotus natalensis CRYD, Cryptomys damarensis GEORY, Georychus capensis HETER, Heterocephalus glaber HELIO, Heliophobius argenteocinereus THRYO, Thryonomys ... http://zoo.bf.jcu.cz/kz/kzcz/kzczdobk.htm Katedra zoologie: ...zima 2004. Jana Biesoková Testovánà Ä?ichových schopnostà rypoÅ¡e stÅ™ÃbÅ™itého (Heliophobius argenteocinereus) pÅ™i lokalizaci potravy R. Å umbera. ... http://zoo.bf.jcu.cz/kz/kzcz/kzczdimg.htm Katedra zoologie: ...pÄ›nic v playbackových experimentech R. Fuchs Jitka Zelová Stanovenà termoneutrálnà zóny rypoÅ¡e stÅ™ÃbÅ™itého (Heliophobius argenteocinereus) a zmÄ›ny ... http://www.signaling-gateway.org/molecule/query?afcsid=A002368&type=blast&adv=latest Blast data for AfCS protein A002368 - Signaling Gateway: 0.00E0, 610.912, 78.38, 14.97, Von Willebrand factor (Fragment) [Heliophobius argenteocinereus (Silvery mole-rat ... http://nema.cap.ed.ac.uk/nematodeESTs/Ascaris/Ascaris200-249/Asmc-224nnr.html National Center for Biotechnology Information (NCBI) welcome to ...: Sbjct: 418 ttattaggaattgatcgtaaaatagcataagcaaataagaaatatcattcagg 366 gb|U87527|HAU87527 Heliophobius argenteocinereus cytochrome-b gene, mitochondrial gene ... https://www.vpk.cz/cgi-bin/dflex/CZE/STK/FULL/163443 Úplný záznam dokumentu: Název, Ecology and reproduction of the Silvery mole-rat (Heliophobius argenteocinereus) : can it help us to understand evolution of sociality in African mole ... https://www.vpk.cz/cgi-bin/dflex/ENG/STK/FULL/163443 Full Record: Title, Ecology and reproduction of the Silvery mole-rat (Heliophobius argenteocinereus) : can it help us to understand evolution of sociality in African mole ... http://bighost.area.ba.cnr.it/srs6bin/wgetz?-id+1nof81L3BfC+%5Btaxonomy-ID:5455%5D+-e Entry Page: Printer_Friendly, TAXONOMY:5455 ID : 10179 PARENT ID : 10178 RANK : species GC ID : 1 MGC ID : 2 SCIENTIFIC NAME : Heliophobius argenteocinereus GENBANK COMMON ... http://newalex.stk.cz/cgi-bin/dflex/CZE/STK/COPY-LIST/165282 PÅ™ehled exemplářů: Ecology and reproduction of the Silvery mole-rat (Heliophobius argenteocinereus) : can it help us to understand evolution of sociality in African mole-rats? ... http://www.chickest.udel.edu/orthomouse/m273.html BLAST Search Results: 72 2e-10 gb|AF231345.1|AF231345 Globicephala macrorhynchus von Wille... 72 2e-10 emb|AJ251133.1|HAR251133 Heliophobius argenteocinereus part... ... http://www.chickest.udel.edu/orthochick/c140.html BLAST Search Results: 85 1e-13 emb|AJ251133.1|HAR251133 Heliophobius argenteocinereus part... 85 1e-13 emb|AJ251143.1|ABE251143 Abrocoma bennettii partial vWF gen... ... http://artedi.ebc.uu.se/cfg2000/blast/COB.blastp_nr.html BLASTP 2.0.9 [May-07-1999]: 400 e-111 gi|2239304 (U87527) cytochrome-b [Heliophobius argenteocinereus] 400 e-110 gi|2352140 (U97161) cytochrome b [Astatheros rostratum] 399 e-110 gi ... http://artedi.ebc.uu.se/cfg2000/blast/bI3.blastp_nr.html BLASTP 2.0.9 [May-07-1999]: 220 3e-56 gi|1117851 (U38264) cytochrome b [Colobus guereza] 219 4e-56 gi|2239304 (U87527) cytochrome-b [Heliophobius argenteocinereus] 219 4e-56 gi|4099744 ... http://www.infobiogen.fr/db/embl-align/ds26901.dat ACCESSION NUMBER: DS26901 TITLE: Higher level systematics of ...: AGAGCTTGTTTG00111010000101110000110001101001100100000010001000110011001011111101 10000011010 Heliophobius argenteocinereus M63562 GCAAG-AATCCCCAAACCA-GTGAAAA ... http://www.infobiogen.fr/db/cutg/CUTG/gbrod.spsum Abrothrix jelskii: 1 0 2 1 0 1 0 1 1 4 2 1 1 1 7 0 4 6 0 1 5 0 2 2 ...: 0 10 6 0 1 1 0 5 4 0 3 2 1 2 3 8 6 0 4 4 2 0 1 6 0 2 2 3 1 3 9 5 0 0 2 8 0 3 0 2 5 4 1 8 5 18 5 11 2 0 2 0 4 mitochondrion Heliophobius argenteocinereus: 1 5 2 ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt AF extant Artiodactyla Bovidae Addax nasomaculatus 4.85 70000.3 60 ...: ...- ... 2.3 200 "63, 70" AF extant Rodentia Bathyergidae Georychus capensis 2.38 239.3 "60, 129" AF extant Rodentia Bathyergidae Heliophobius argenteocinereus 2.26 181 ... http://www.esapubs.org/archive/ecol/E084/093/Mammal_lifehistories_v2.txt order family Genus species mass(g) gestation(mo) newborn(g) ...: Rodentia Bathyergidae Georychus capensis 181.00 1.47 8.40 0.57 36.00 10.00 36 5.95 2.00 "1,2" Rodentia Bathyergidae Heliophobius argenteocinereus 160.00 2.90 ... http://obd.jcu.cz/cgi-bin/detail.cgi?id=2002014 Výsledky vyhledánÃ: Titul: Eimeria burdai sp n. (Apicomplexa : Eimeriidae), a new parasite species from subterranean African silvery mole-rat, Heliophobius argenteocinereus. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/SYNOM/MAM70SYN.txt PRINTNAME SYNON_NAME ORIG_NM AUTHOR CITATION NOTES Hystricognathi ...: Georychus capensis canescens Georychus capensis leucops Georychus capensis yatesi Heliophobius Myoscalops Heliophobius argenteocinereus albifrons Heliophobius ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/TAXON/HYSTRIC.txt ME MYPARENT RORDER NAME TAXON PRINTNAME AUTHOR CITATION COMMON_NM ...: Silvery Mole-rat. <^Heliophobius argenteocinereus^> Peters, 1846. SE Africa. 17 16 0 argenteocinereus SPECIES Heliophobius argenteocinereus Peters, 1846. ... http://www.bf.jcu.cz/english/13zool.html Faculty of Biological sciences - University of South Bohemia: F. (2000): Eimeria burdai sp n. (Apicomplexa: Eimeriidae), a new parasite species from subterranean African silvery mole-rat, Heliophobius argenteocinereus. ... http://rdp.cme.msu.edu/download/SSU_rRNA/SSU_Mito.alpha (July 31, 1998) MITOCHONDRIAL SMALL SUBUNIT rRNA: ALPHABETICALLY ...: 289] Hlcv.pun_M Helicoverpa punctigera (budworm moth; Australian moth) -- mitochondrion [1197] Hlph.arg_M Heliophobius argenteocinereus (silvery mole-rat ... http://www.lib.cas.cz/knav/asep/data/PAU00.HTM PAU 2000: SedláÄ?ek, F. Eimeria burdai sp.n. (Apicomplexa:Eimeriidae), a new parasite species from subterranean African silvery mole-rat, Heliophobius argenteocinereus. ... http://www.lib.cas.cz/www/asep/data/ZFG01.HTM ZFG 2001: UZFG-Y 20010083 RIV DE eng J Scharff, A. - Macholán, M. - Zima, J. - Burda, H. A new karyotype of Heliophobius argenteocinereus (Bathyergidae, Rodentia) from ... http://industry.ebi.ac.uk/~alan/BioWidget/Taxonomy/tax4.data 1 root 1 2759 Eukaryotae 1 42452 unclassified eukaryotes 2759 ...: 10162 10167 Bathyergidae 33550 10176 Georychus 10167 10177 Georychus capensis 10176 10178 Heliophobius 10167 10179 Heliophobius argenteocinereus 10178 10180 ... http://rodentbe.free.fr/nederlands/infos/taxonomie.php3 .::Rodent::.: Cryptomys zechi. Georychus. Georychus capensis. Heliophobius. Heliophobius argenteocinereus. Heterocephalus. Heterocephalus glaber. Family Hystricidae. Atherurus. ... http://members.tripod.com/rodentvzw/rodentnederlands/Taxonomie/bathyergidae.htm Bathyergidae: Cryptomys zechi. Georychus. Georychus capensis. Heliophobius. Heliophobius argenteocinereus. Heterocephalus. Heterocephalus glaber. Last update 17/10/2003. ... http://tinweb.jcu.cz/~hanakm/novinky/bf/0204.htm Nove knihy: Testovánà Ä?ichových schopnostà rypoÅ¡e stÅ™ÃbÅ™itého (Heliophobius argenteocinereus) pÅ™i lokalizaci potravy [Biesoková, 2004] / Jana Biesoková . ... http://bioinfo.hku.hk/db/cutg/gbrod.spsum Acomys cahirinus: 2 1 12 8 4 1 4 2 7 11 3 1 6 3 12 2 3 13 2 5 16 2 ...: 0 10 6 0 1 1 0 5 4 0 3 2 1 2 3 8 6 0 4 4 2 0 1 6 0 2 2 3 1 3 9 5 0 0 2 8 0 3 0 2 5 4 1 8 5 18 5 11 2 0 2 0 4 Mitochondrion Heliophobius argenteocinereus: 1 5 2 ... http://www.nouvellesapproches.org/PNK/faune/PNUmami_ang.htm Nouvelle page 1: Tatera lobengulae Lisulu. Tatera böhmi Lisulu. Bathyergidae. Heliophobius argenteocinereus Pengele. Cryptomys mellandi Kapindifuku, Kafukwa. Bats (Chiroptera). ... http://www.virologia.unimi.it/~prea/rodents/lists/lower.html [an error occurred while processing this directive] Heliophobius argenteocinereus [an error occurred while processing this directive] 9828 Silvery Mole Rat Silvery Mole Rat Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |