|
|
Lophuromys flavopunctatus - Yellow-Spotted Brush-Furred RatIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.blackwell-synergy.com/links/doi/10.1046/j.1365-2028.2003.00386.x/abs/ Habitat occurrence and feeding ecology of Crocidura montis and ...: 00386.x. Habitat occurrence and feeding ecology of Crocidura montis and Lophuromys flavopunctatus on Mt. Elgon, Uganda. V. Clausnitzer ... http://www.blackwell-synergy.com/links/doi/10.1046/j.1365-2028.2003.00383.x/full/ Diversity of rodents and shrews along an elevational gradient in ...: Habitat preference. Lophuromys flavopunctatus was found to occupy all sites sampled, whereas certain species showed a preference for certain habitat types. ... http://www.fao.org/docrep/w7540e/w7540e07.htm 2.3 Nutritional value meat from wild animals: 526. 126. 280. 225. 10. Lophuromys flavopunctatus, 601. 144. 300. 170. 7. ... 2.6. Dasysmys sp. 71.7. 21.0. 4.0. 2.0. Lophuromys flavopunctatus, 66.7. 27.5. 2.9. 2.6. Praomys sp. 70.0. ... http://lib.ua.ac.be/AB/a4668.html Academic bibliography for | Academische bibliografie voor ...: WN, Hulselmans JLJ, Dierckx T., Verheyen E.. - A craniometric and genetic description of two new species from the Lophuromys flavopunctatus THOMAS 1888 sl ... http://www.fmnh.org/tanzania/eam_rodent.html Eastern Arc Rodents: Lophuromys flavopunctatus – Eastern Brush-furred Rat Lophuromys is a very distinctive rodent with a deep red dorsal fur and orange belly. ... http://www.fmnh.org/tanzania/eam_rodent_swa.html Eastern Arc Rodents: Lophuromys flavopunctatus – Panya wa Vichakani mwenye manyoya Lophuromys ni panya aliye tofauti kabisa, mwenye manyoya ya mgongoni mekundu sana na tumbo ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Leptomys signatus. Limnomys sibuanus. Lophuromys cinereus. Lophuromys flavopunctatus. Lophuromys luteogaster. Lophuromys medicaudatus. Lophuromys melanonyx. ... http://www.naturalsciences.be/science/organigram/molelabo/vertebrates/mammals Research department of Royal Belgian Institute of Natural Sciences: A craniometric and genetic description of two new species from the Lophuromys flavopunctatus THOMAS 1888 sl species complex (Rodentia – Muridae – Africa). ... http://www.sevin.ru/agreements/teriofauna/191-200.html Ð?аучные Советы: ТЕРИОЛОГИЧЕСКОЕ ...: процеÑ?Ñ?ов в Ñ?волюции Ñ?фиопÑ?ких предÑ?тавителей Lophuromys flavopunctatus Лавренченко Л.Ð?. ... http://www.sevin.ru/agreements/teriofauna/materials.html Ð?аучные Советы: ТЕРИОЛОГИЧЕСКОЕ ...: и ретикулÑ?рных процеÑ?Ñ?ов в Ñ?волюции Ñ?фиопÑ?ких предÑ?тавителей Lophuromys flavopunctatus. [181..190]. ... http://www.natuurwetenschappen.be/science/library/bib_ech/bio_72/ Onderzoek : Koninklijk Belgisch Instituut voor Natuurwetenschappen: VERHEYEN, W., HULSELMANS, JLJ, DIERCKX, T. & VERHEYEN, E., The Lophuromys flavopunctatus THOMAS 1888 sl species complex : a craniometric study, with the ... http://www.biologie.uni-ulm.de/gtoe/abstracts/clausnit.htm Einfluß von Feuer, Klima und Vegetation auf afroalpine Nagetiere: ...- ... Vor allem die endemische Otomys barbouri, die disjunkt verbreiteten O. typus und Rhabdomys pumilio und der Ubiquist Lophuromys flavopunctatus wurden im ... http://www.savci.upol.cz/hlod-3.htm Rodentia - Hlodavci: Lophuromys cinereus Dieterlen & Gelmroth, 1974 - krysa - Gray Brush-furred Rat Lophuromys flavopunctatus Thomas, 1888 - krysa hrubosrstá - Yellow-spotted Brush ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=585036 ITIS Standard Report Page: Lophuromys: Species, Lophuromys cinereus Dieterlen and Gelmroth, 1974, Species, Lophuromys flavopunctatus Thomas, 1888, Species, Lophuromys luteogaster Hatt, 1934, ... http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=57 ITIS 'Expert(s)' Search results for Guy G. Musser: Lophuromys cinereus Dieterlen and Gelmroth, 1974 -- valid. Lophuromys flavopunctatus Thomas, 1888 -- valid. Lophuromys luteogaster Hatt, 1934 -- valid. ... http://www.wolfology.com/id120.htm Abstracts - B: Three species -- Lophuromys flavopunctatus, Stenochepalemys griseicauda and Otomys typus -- characterize the montane grasslands. ... http://legato.bib.uia.ac.be/acadbib/UA/bib_4668.html Hulselmans, Jan: Verheyen WN, Hulselmans JLJ, Dierckx T., Verheyen E..- A craniometric and genetic description of two new species from the Lophuromys flavopunctatus THOMAS 1888 ... http://www.env.leeds.ac.uk/elgon/appendixm1.html Appendix (An investigation into small mammal community composition ...: Lophiomys imhausi, Crested Rat, x, Lophuromys flavopunctatus, Eastern Brush-furred Rat, x, x. Lophuromys sikapusi, Common Brush-furred Rat, x, ... http://www.env.leeds.ac.uk/elgon/mammal2.html A study of the small mammal communities of Mount Elgon National ...: Lophuromys flavopunctatus showed highest abundance in the burnt bushland and was present in it’s lowest numbers in the grassland. ... http://www.up.ac.za/academic/acadorgs/zssa/journal/v36.html Contents and abstracts: Oocysts of Eimeria livingstonei n.sp., found in Lophuromys flavopunctatus Thomas, 1888, are spindle-shaped, 19.6 (17.0-22.0) x 13.6 (12.5-15.0) æm, with a ... http://www.blackwellpublishing.com/issue.asp?ref=0141-6707&vid=41&iid=1&oc=&s=&site=1 African Journal of Ecology Issue: Volume 41: Issue 1, March 2003. Contents: 1-8 Habitat occurrence and feeding ecology of Crocidura montis and Lophuromys flavopunctatus on Mt. Elgon, Uganda. ... http://www.uni-marburg.de/geographie/HPGeo/personal/clausnitzer/clausnitzer.htm Homepage Viola Clausnitzer: 6(1): 1-8. Clausnitzer, V., Churchfield, S., Hutterer, R. (2003) Habitat occurrence and feeding ecology of Crocidura montis and Lophuromys flavopunctatus on Mt ... http://diglib1.amnh.org/cgi-bin/database/search.cgi?pagemode=search;search_recordtype=all;search_locality=Niangara AMNH Congo Expedition Search Results: More Information. > View Related Field Notes. Yellow-spotted brush-furred rat. Lophuromys flavopunctatus. Locality: Niangara, Congo Belge. ... http://diglib1.amnh.org/resources/bibliography/bibliographies/conservation.htm Conservation: Small-mammal species observed were Deomys ferrugineus, Hybomys univittatus, Hylomyscus stella, Lophuromys flavopunctatus, Malacomys longipes, Mns minutoides ... http://www.wildcru.org/research/es/ethiopianwolf/ewcp/ewolf.htm EWCP - Ethiopian wolves: Other prey species included Otomys typus, Lophuromys flavopunctatus, and occasionally goslings and eggs and rock hyrax (Procavia capensis). ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: ACACGAACTTAACTACATTCCGGAGACGACAGAAATGGAAGAGAGTGAACTTGATACTCA >Lophuromys flavopunctatus breast cancer protein 1 (BRCA1) gene, exon 11 and partial cds ... http://groups.yahoo.com/group/ifl-tech2000/message/829 Yahoo! Groups : ifl-tech2000 Messages : Message 829 of 1137: Habitat occurrence and feeding ecology of Crocidura montis and Lophuromys flavopunctatus on Mt. Elgon, Uganda V. Clausnitzer, S. Churchfield ... http://www.br.fgov.be/cgi-bin/BIODIV/research.pl?res_id=762 Search results for research title: Systematic and distributional notes on the Lophuromys flavopunctatus Thomas, 1888 species-complex in Ethiopia (Muridae - Rodentia). ... http://www.vliz.be/vmdcdata/Imis2/Ref.php?show=html&refid=35969 VLIZ - Integrated Marine Informations System: We revised the taxonomy of the East African Lophuromys flavopunctatus species complex using craniometric data of nearly 3000 specimens grouped in 49 ... http://www.ingenta.com/isis/browsing/TOC/ingenta?issue=pubinfobike://bsc/afje/2003/00000041/00000001 Ingenta: Table of Contents -- African Journal of Ecology, March ...: ...this journal, 1. Habitat occurrence and feeding ecology of Crocidura montis and Lophuromys flavopunctatus on Mt. Elgon, Uganda Clausnitzer ... http://www.pasteur.fr/recherche/banques/CRORA/bibref/br01100.htm CRORA : VIRUS DE REFERENCE Witwatersrand: ...- ... HOTES OU VECTEURS : Mammifères : Arvicanthis niloticus, Hamsters sentinelles, Lophuromys flavopunctatus. Moustiques : Culex rubinotus. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...elegans Leptomys ernstmayri Leptomys signatus Limnomys sibuanus Lophuromys #1 Lophuromys #2 Lophuromys cinereus Lophuromys flavopunctatus Lophuromys huttereri ... http://www.cs.ubc.ca/~jslack/tj/mammalia_A_03-04-16.nh (((((('platypus')'ornithorhynchus')'ornithorhynchidae' ...: ...leptomys ernstmayri','leptomys signatus')'leptomys',('limnomys sibuanus')'limnomys',('lophuromys cinereus','lophuromys flavopunctatus','lophuromys luteogaster ... http://www.bioone.org/bioone/?request=get-document&issn=0022-2372&volume=081&issue=03&page=0758 BODY MASS, TESTES MASS, AND SPERM SIZE IN MURINE RODENTS: Short-tailed sperm were evident in Aethomys ineptus and Lophuromys flavopunctatus from Africa and Pseudomys shortridgei, P. delicatulus, and P. pilligaensis ... http://www.rodent.be/rodentfrans/Taxonomie/muridae.htm Muridae: Limnomys. Limnomys sibuanus. Lophuromys. Lophuromys cinereus. Lophuromys flavopunctatus. Lophuromys luteogaster. Lophuromys medicaudatus. Lophuromys melanonyx. ... http://www.psb.ugent.be/rRNA/ssu/list/Mitochondria.html ssu rRNA Mitochondria: Locusta migratoria X80245; Mit. Lophotus capellei AF049727; Mit. Lophuromys flavopunctatus U67294; Mit. Loxodonta africana AJ224821; Mit. ... http://geta.life.uiuc.edu/RDP/data/SubUnal/Unal_alpha.L.html SSU Unaligned rRNA Alphabetic List -- "L": None·····LFU67294·····Mitochondrion Lophuromys flavopunctatus None·····None ... http://www.museumkoenig.uni-bonn.de/mit/dmit_hutter2.htm Museum Koenig - Mitarbeiter / Hutterer, Rainer (D): Clausnitzer, V., Churchfield, S. & Hutterer, R. 2003. Habitat occurrence and feeding ecology of Crocidura montis and Lophuromys flavopunctatus on Mt. ... http://riviste.neteditor.it/tz/articoli.php?idelemento2=558 NetEditor - Sezione Tz: ...above 3500 m asl In this study, 13 species belonging to the Muridae were recorded, but only one species Lophuromys flavopunctatus Thomas1888, occurred in all ... http://www.infobiogen.fr/db/embl-align/ds26901.dat ACCESSION NUMBER: DS26901 TITLE: Higher level systematics of ...: AGAGCTTAATTG00100011001101000010001011100001110000010001001000100010001011111111 10100111010 Lophuromys flavopunctatus U67294 GCAAA-TCTCCATATTCCG-GTGTCAA ... http://143.129.203.3/evobio/Publicaties/Refereed.htm Refereed journals: Verheyen, W., Hulselmans, JLJ, Dierckx, T. & Verheyen, E. (2002) The Lophuromys flavopunctatus Thomas 1888 sl species complex: a craniometric study, with the ... http://www.kluweronline.com/article.asp?PIPS=297691 Allozyme Variability among Populations of Three Species of Brush ...: File Format: Unrecognized ... Abstract Allozyme variability was examined in populations of three endemic species of the species complex Lophuromys flavopunctatus sensu lato: L. chrysopus, L ... http://www.phthiraptera.org/Mammals/Muridae.html Mammals: Muridae: Polyplax smallwoodae Johnson, 1960 * (host Lophuromys sp.). Lophuromys flavopunctatus Thomas, 1888 - Yellow-spotted Brush-furred Rat ... http://icz.ioz.ac.cn/viewreg/regform1view.asp?key=605 Institution: Title (Oral): Breeding seasonality and population dynamics of three rodent species (Lophuromys flavopunctatus, Grammomys dolichurus and Praomys delectorum) in ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt AF extant Artiodactyla Bovidae Addax nasomaculatus 4.85 70000.3 60 ...: ...- ... Lophuromys sikapusi 1.9 79.6 135 AF extant Rodentia Muridae Lophuromys woosnami 1.62 42.2 135 AF extant Rodentia Muridae Lophuromys flavopunctatus 1.78 60 "63 ... http://www.suanet.ac.tz/fvm/kilonzo%20vetpara.htm SUA - Faculty of Veterinary, Department of Microbiology and ...: ...the multimmate or Shamba rat), Arvicanthis niloticus ( the common un-striped grass mous) and to lesser extent Lophuromys flavopunctatus/sikapusi) (the ... http://bch-cbd.naturalsciences.be/congodr/cdr-fra/contribution/strataction/etat/annexes/tab7.htm Mammifères des parcs nationaux du Congo: ...- ... macculus macculus Lemniscomys striatus massaicus Lepus crawshayi - Lièvre Lepus crawshayi Lophuromys luteogaster Lophuromys flavopunctatus Lophuromys woosnami ... http://www.nouvellesapproches.org/PKB/faune/mamal_fr.htm [an error occurred while processing this directive] Lophuromys flavopunctatus [an error occurred while processing this directive] 12353 Yellow-Spotted Brush-Furred Rat Yellow-Spotted Brush-Furred Rat Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |