|
|
Mastomys hildebrandtii - Hildebrandts Multimammate MouseIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=585043 ITIS Standard Report Page: Mastomys: Species, Mastomys erythroleucus (Temminck, 1853), Species, Mastomys hildebrandtii (Peters, 1878), Species, Mastomys natalensis (Smith, 1834), ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=Mastomys+hildebrandtii+%5Bgbrod%5D Codon usage table: Mastomys hildebrandtii [gbrod]: 2 CDS's (354 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 11.3( 4) UCU 2.8 ... http://www.kazusa.or.jp/codon/M.html Alphabetical list: M: Mastadenovirus [gbvrl]: 15 Mastigamoeba balamuthi [gbinv]: 17 Mastigocladus laminosus [gbbct]: 12 Mastomys coucha [gbrod]: 3 Mastomys hildebrandtii [gbrod]: 2 ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Mastomys angolensis. Mastomys coucha. Mastomys erythroleucus. Mastomys hildebrandtii. Mastomys natalensis. Mastomys pernanus. Mastomys shortridgei. Mastomys verheyeni. ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Retrieve&dopt=Citation&list_uids=97176443 Substitution rate variation in closely related rodent species.: ...of rodents we have sequenced the adenine phosphorybosyltransferase (APRT) gene from Mus spicilegus, Mus pahari, Mastomys hildebrandtii, Stochomys longicaudatus ... http://www.carnegiemuseums.org/cmnh/mammals/collections/holo.html Publications: MURIDAE, MASTOMYS, HILDEBRANDTII, GARDULENSIS, M, ETHIOPIA, GEMU-GWEFA, SS, 27 MAR 1912, RAFFERTY DG, CM 3447, HOLOTYPE - EPIMYS HILDEBRANTI GARDULENSIS. FRICK C 1914. ... http://www.env.leeds.ac.uk/elgon/tab9m1.html Table 9 (An investigation into small mammal community composition ...: Praomys jacksoni, XX, X, XX, XX. Hylomyscus denniae, XX, X, XX, X. Mastomys hildebrandtii, XX, X, X. Mus triton, XX, X, XX. Mus minutoides, XX, XX. Oenomys hypoxanthus, X, X. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...elegans Margaretamys parvus Mastomys angolensis Mastomys awashensis Mastomys coucha Mastomys erythroleucus Mastomys hildebrandtii Mastomys natalensis Mastomys ... http://www.ifauna.cz/clanky/clanek.php?id=1625&rubrika=11 iFAUNA: ÄŒlánkyKrysa malá: Do rodu Mastomys zaraÄ?ujeme: Mastomys coucha Mastomys angolensis Mastomys erythroleucus Mastomys hildebrandtii Mastomys natalensis Mastomys pernanus Mastomys ... http://exon.bic.nus.edu.sg/~meena/sege/gb130/gbrod2.output 1_AL589738 DEFINITION Mouse DNA sequence from clone RP23-322J11 on ...: 45_AY057818 DEFINITION Mastomys hildebrandtii cytochrome b (Cytb) gene, complete cds; mitochondrial gene for mitochondrial product. ... http://www.savci.upol.cz/hlod-3.htm Rodentia - Hlodavci: ...krysa malá - Southern Multimammate Mouse Mastomys erythroleucus (Temminck, 1853) - krysa - Guinea Multimammate Mouse Mastomys hildebrandtii (Peters, 1878 ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: AAACCCCAAGGAACTCGTCCGTGGTTCTAACAGTGCCGGAAGTGGCATAGAGTACTCGAAGCACCCATTG AGACACGAGCTTAACACGGTCAGGAGACAG >Mastomys hildebrandtii breast cancer protein 1 (BRCA1 ... http://sege.ntu.edu.sg/cgi-bin/extract_info.pl?dbase=gbrod&field=protein&pop=179&type=1 Your Search Results: 44494_MHU28722 Mastomys hildibrantii adenine phosphoribosyltransferase (APRT)gene, complete cds.!Nuclear !Orgn:Mastomys hildebrandtii =nid(g881571) =axn(U28722 ... http://www.cs.ubc.ca/~jslack/tj/mammalia_A_03-04-16.nh (((((('platypus')'ornithorhynchus')'ornithorhynchidae' ...: ...elegans','margaretamys parvus')'margaretamys',('mastomys angolensis','mastomys coucha','mastomys erythroleucus','mastomys hildebrandtii','mastomys natalensis ... http://bioinfo.hku.hk/db/cutg/gbrod.spsum Acomys cahirinus: 2 1 12 8 4 1 4 2 7 11 3 1 6 3 12 2 3 13 2 5 16 2 ...: 1 0 0 0 0 3 1 1 0 5 2 0 0 0 3 2 2 1 0 3 1 1 3 2 3 0 1 3 5 1 1 2 1 0 2 1 2 3 1 4 7 2 2 0 2 3 2 2 3 1 2 5 2 5 6 3 2 0 1 5 5 0 0 1 0 Mastomys hildebrandtii: 2 2 5 ... http://www.infobiogen.fr/db/cutg/CUTG/gbrod.spsum Abrothrix jelskii: 1 0 2 1 0 1 0 1 1 4 2 1 1 1 7 0 4 6 0 1 5 0 2 2 ...: 5 2 12 18 4 0 3 2 7 3 4 11 3 3 13 2 9 10 12 1 9 7 11 1 5 3 9 3 4 5 6 11 2 6 12 4 5 1 6 6 3 8 10 9 3 11 5 21 18 9 3 4 9 5 11 5 1 1 1 Mastomys hildebrandtii: 2 2 ... http://genome.jgi-psf.org/cgi-bin/dispGeneModel.v4?db=whiterot1&id=72907 Protein Pages: Phanerochaete chrysosporium (White Rot fungus): ...genome.jgi-psf.org/cgi-bin/ dispGeneModel.v4?db=whiterot1&id=72907 - 27k - Cached - Similar pages Mammals: Muridae ... Mastomys hildebrandtii (Peters, 1878) - Hildebrandt´s Multimammate Mouse; Mastomys natalensis (Smith, 1834) - Natal Multimammate Mouse ... http://www.phthiraptera.org/Mammals/Muridae.html Mammals: Muridae: Mastomys hildebrandtii (Peters, 1878) - Hildebrandt´s Multimammate Mouse; Mastomys natalensis (Smith, 1834) - Natal Multimammate Mouse ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt [an error occurred while processing this directive] Mastomys hildebrandtii [an error occurred while processing this directive] 12867 Hildebrandts Multimammate Mouse Hildebrandts Multimammate Mouse Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |