|
|
Meriones shawi - Shaw's JirdIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://users.bart.nl/~fredveen/other.htm The Other Gerbil Species: MERIONES REX, KING JIRD. MERIONES SACRAMENTI, NEGEV JIRD (Buxton's jird). MERIONES SHAWI, SHAW'S JIRD. MERIONES THOMASI ??? THOMAS JIRD. ... http://www.gerbil-info.com/html/othershawiuk.htm Shaw's Jird: Scientific Name: Meriones shawi. Next are two pictures to show the differences between Meriones shawi, and Meriones crassus perpallidus. ... Meriones shawi isis. ... http://www.gerbil-info.com/html/othercrassusuk.htm Sundevall's Jird: ...bottom: Meriones crassus perpallidus (from Egypt) (in Holland and Germany previously known as Meriones shawi II, some time incorrectly thought to be Meriones ... http://www.funet.fi/pub/sci/bio/life/mammalia/rodentia/gerbillidae/meriones/ Meriones: Meriones shawi (Duvernoy, 1842) Shaw's Jird Gerbillus shawi Duvernoy, 1842; (Oman, Algeria) savii albipes auziensis crassibulla grandis; (Morocco) isis; (Egypt ... http://www.funet.fi/pub/sci/bio/life/warp/mammals-English-index-j.html All (in this database) Mammals list (with English common names): Meriones persicus); Gerbils and Jirds (Gerbillidae); Shaw's Jird (Meriones shawi); Tristram's Jird (Meriones tristrami); Vinogradov's ... http://home.arcor.de/morganlefeysclan/arten.htm arten meriones shawi: ...- ... seidiger. Ihre Krallen sind hell. Hier die ehemaligen Meriones shawi von Andrea Behle. Sie ähneln den Tieren von Andrea Hoffmann. ... http://home.arcor.de/morganlefeysclan/unterarten.htm Unterarten: ...- ... Vor einigen Jahren noch relativ häufig in Deutschland gehalten war die Große Shaw-Rennmaus (Meriones shawi grandis) die ursprünglich aus Marokko stammt. ... http://koti.mbnet.fi/jpk1985/merionesshawi.php Eremita: Shawin Jirdi (Meriones Shawi). Shawin Jirdi? ... Shawin Jirdi, tieteelliseltä nimeltänsä meriones shawi, on Suomessa hyvin suositun lemmikkigerbiilin sukulainen. ... http://koti.mbnet.fi/jpk1985/kuvagalleria/index.php Eremita - Kuvagalleria: 03.Gryllus bimaculatus. 03.Gryllus bimaculatus. 1 kuvaa (43 kt). 04.Meriones Shawi. 04.Meriones Shawi. 2 kuvaa (123 kt). 05.Taustakuvat. 05.Taustakuvat. ... http://www.petermaas.nl/gerbils/sundevallsjirds.htm The Sundevall's Jird Page (Meriones crassus): But this subspecies is not as large as a fully-grown Shaw’s Jird (Meriones shawi). This species are a very attractive gerbil. ... http://www.petermaas.nl/gerbils/sundevallgerbils.htm De Sundevall Gerbil pagina (Meriones crassus): ...perpallidus) is een stuk groter dan de Mongoolse gerbil en wat ronder van vorm, maar ook weer niet zo groot dan een volwassen shawi gerbil (Meriones shawi). ... http://www.ig-rennmaeuse.de/shawrennmaus.htm meriones shawi: ...- Interessengemeinschaft Rennmäuse. Shaw-Rennmaus (Meriones shawi). Systematik. Infos. Haltung. Ernährung. Vergesellschaftung. Fotogalerie. Unterarten. Zucht. ... http://www.ig-rennmaeuse.de/andererennmausarten.htm rennmausarten im ueberblick: ...- ... Cheng´s Jird (Meriones chengi). Dahl´s Jird (Meriones dahli). Grosse Shaws Rennmaus (Meriones shawi grandis). ... Shaw's Rennmaus, Shaw´s Jird (Meriones shawi). ... http://www.exotische-nager.de/Shaw-Rennmaus.htm Shaw-Rennmaus: ...- ... englisch. Shaw´s Jird. latein. Meriones shawi. Systematik. Ordnung. Rodentia (Nager). ... Gattung. Meriones. Art. Meriones shawi. Sonstiges. Herkunft. Ägypten, Marokko. ... http://www.exotische-nager.de/Sundevall-Rennmaus.htm Sundevall Rennmaus: ...- ... nachts aktiv. Haltung. Sundevall-Rennmäuse (unten) werden häufig mit Meriones shawi (oben) verwechselt. Sundevall-Rennmäuse sind ... http://www.ifrance.com/nblanluet/infogen/origine.htm Origine de la gerbille: ...- ... Un de ses très proches cousins est Meriones Shawi, ou "mérione de Shaw", qui lui ressemble beaucoup mais fait à peu près deux fois sa taille. ... http://www.ifrance.com/Go-South/lists/mammiferes.htm Mammals of Morocco - Mammifères du Maroc: ...- ... Pachyuromys duprasi - Pachyuromys. Meriones shawi - Mérione de Shaw. Meriones libycus - Mérione à queue rouge. Meriones crassus - Mérione du désert. ... http://www.rennmaus4u.de/34255.html?*session*id*key*=*session*id*val* Mongolische Rennmäuse und Exotische Nager: ...- ... Unterordnung: Myomorpha (Mäuseartige) Familie: Cricetidae (Wühler) Unterfamilie: Gerbillinae (Gerbils) Gattung: Meriones Art : Meriones shawi grandis. ... http://www.hobitinkolo.net/shawi/mikashawi.html Mikä ihmeen shawi?: Hobitinkolon Gerbiilit, Suomen Gerbiiliyhdistys ry. ) sukulainen. Tieteellisesti se tunnetaan nimellä meriones shawi. Kyseessä ... http://www.animalhospitals-usa.com/small_pets/gerbils.html Gerbils - Animal Hospitals-USA: Other jirds also kept as pets include Sundevall's Jird (Meriones crassus), the Libyan Jird (Meriones libycus), and Shaw's Jird (Meriones shawi). ... http://www.geocities.com/woestijn_rat/anderegerbils.html anderegerbils: ...de SUNDEVALL en NEVEV-GERBIL, waarvan de verschillende ondersoorten bekend zijn, de DIKSTAART GERBIL (pachyuromys duprasi) en de SHAWI-GERBIL ( Meriones shawi ... http://www.geocities.com/dustydog125/fanlistings/jirdabout.html Meriones: the jird fanlisting: Shaw's Jirds Shaw's Jirds (Meriones shawi), with their outgoing, curious, and intelligent disposition, are the most popular jird species to be kept as a pet ... http://www.afeq.cnrs-bellevue.fr/sommaire2002-2.html SansTitre: ...- ... Les rongeurs sont peu diversifiés et ne comprennent que trois espèces : Hystrix aff. cristata (Hystricidae), Meriones shawi (Gerbilidae) et Mastomys sp. ... http://www.gerbils.pwp.blueyonder.co.uk/gerbils/jird.htm Shaw's Jird: WHAT THEY ARE. The Shaw's Jird (Meriones shawi) is about the same size as a rat and looks like a giant version of the Mongolian Gerbil. ... http://www.gerbils.pwp.blueyonder.co.uk/gerbils/species.htm Gerbil Species List: Sandrennmaus, Southern Israel. Meriones shawi, Shaw's Jird; Dutch: Shawi gerbil; German: Shaw-Rennmaus, Morocco to Egypt. Meriones unguiculatus, ... http://www.zoozity.dk/Pas_ShawsGerbil.asp Zoo Zity - Din internet dyrehandel -: Udskriv vejledning Beskrivelse Dansk navn : Shaws gerbil og Stor Shaws gerbil Latinsk navn : Meriones shawi og Meriones shawi grandis Udbredelse : Egypten ... http://www.zoozity.dk/PR_Pas_ShawsGerbil.asp Pasning og fodringsvejledning til Hamster: Beskrivelse Dansk navn : Shaws gerbil og Stor Shaws gerbil Latinsk navn : Meriones shawi og Meriones shawi grandis Udbredelse : Egypten, Libyen, Tunesien ... http://www.home.zonnet.nl/verharen32/Gerbil_en_zijn_gewoonten/shawi/tekst.htm Egyptische gerbil: De Shawi gerbil (Meriones shawi), is verwant aan de Mongoolse gerbil. Hij is alleen iets groter. De Shawi gerbil komt uit het gebied ... http://www.diebrain.de/re-info.html Renner Info - Kurzinfo: ...- ... Etwas öffter in der Heimtierhaltung kommt seit neuestem die Shawi Rennmaus vor (Meriones shawi) sie ist eher ein Einzelgänger, ca. 12 - 14 cm groß. ... http://www.rongeurs.net/Especes/Gerbille/Autres.php3 Gerbilles moins communes: ...- ... C'est une proche parente de notre mérione de Mongolie. Le Genre est le même mais l'espèce diffère. Il s'agit de la gerbille de Shaw, Meriones shawi. ... http://www.il-st-acad-sci.org/mammals/gerbil01.html GERBILS AND JIRDS: Buxton's Jird, Meriones sacramenti. Shaw's Jird, Meriones shawi. Mongolian Gerbil, Meriones unguiculatus. Zarudny's Gerbil, Meriones zarudnyi. Genus Gerbillus. ... http://www.gerbiiliyhdistys.fi/harvinaiset/hkaavio.html SGY ry - Systemaattinen kaavio hyppymyyristä: Sundevallin jirdi, Jerusalemin Jirdi) Meriones libycus (libyan jirdi) Meriones persicus (persian jirdi, persian hyppymyyrä) Meriones shawi (shawin jirdi ... http://www.gerbiiliyhdistys.fi/harvinaiset/shoito.html SGY ry - Shawin jirdin hoito-ohje: Shawin jirdin hoito-ohje. (Meriones shawi). Shawin jirdi on uusi tulokas Suomen lemmikkimarkkinoilla. Muuallakin maailmassa se on melko harvinainen lemmikkinä. ... http://biology.unm.edu/biology/coccidia/rodents.html Coccidia of the World: Eimeria araxena Musaev & Veisov 1960. Host: Meriones shawi. Reference: Musaev & Veisov (1960). ... Host: Meriones shawi. Reference: Musaev & Veisov (1960). ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Meriones persicus. Meriones rex. Meriones sacramenti. Meriones shawi. Meriones tamariscinus. Meriones tristrami. Meriones unguiculatus. Meriones vinogradovi. ... http://www.kolumbus.fi/sarakontu/jyrs.html Pienet lemmikkinisäkkäät: Shawinjirdi Tieteellinen nimi: Meriones shawi Muut suomenkieliset nimitykset: shawi, shawingerbiili Englanninkieliset nimet: Shaw's Jird Ruotsinkieliset nimet ... http://drugs-online-usa.com/ref-vasopressin/vasopressin-research-abs5.46.html Historadioautographic localisation of oxytocin and vasopressin ...: Historadioautographic localisation of oxytocin and vasopressin binding sites in the central nervous system of the merione (Meriones shawi). ... http://www.glenoakzoo.org/Common%20Name.htm Common Name: 160. PERSIAN JIRD. Meriones persicus. 161. SHAW'S JIRD. Meriones shawi. 164. VINOGRADOV'S JIRD. Meriones vinogradovi. Kangaroo Rat. 84. BANNER-TAILED KANGAROO RAT. ... http://www.zzf.de/zza/030336.html ZZF: ZZA 3/2003 S. 36: Neugierig und verspielt: die Ägyptische ...: ...- ... Sundevall-Rennmaus (Meriones crassus perpallidus), nicht zu verwechseln mit der Pakistan-Rennmaus (Meriones crassus) oder der Shaw-Rennmaus (Meriones shawi). ... http://members.lycos.nl/gerbilsonline/engspecies.htm Species: ...they use in dry seasons. Shawi gerbil(meriones shawi): Habitat:Desserts in Nothern Africa and parts of Egypt. This gerbil is not ... http://members.lycos.nl/gerbilsonline/soorten_gerbils.htm Soorten gerbils: ...kunnen profiteren. Shawi gerbil(meriones shawi): Woongebied:Woestijngebieden in Noordelijk Afrika en delen van Egypte. Deze gerbil ... http://www.vez.nl/lijsten/dl0103.htm Gerbils (Gerbillinae): Perzische gerbil, Meriones persicus, Negev gerbil, Meriones sacramenti, Shawi gerbil, Meriones shawi shawi, Mongoolse gerbil, Meriones unguiculatus, ... http://homepage.ntlworld.com/jean.wright3/species.htm Small&Furries - Species Information List: Meriones persicus. Roborovski Hamster - Phodopus roborovskii. Shaw's Jird - Meriones shawi. Spiny Mouse - genus Acomys. Steppe Lemming ... http://homepage.ntlworld.com/jean.wright3/articles/breedingshaws/breedingshaws.htm Breeding Shaw's Jirds: ...web site counters Breeding Shaw's Jirds. Shaw's Jirds. There is much controversy about the way in which to keep and breed this species ... http://members.tripod.com/~Nager/dic5.htm Rodent Dictionary: ...- ... Mongolian gerbil, clawed jird, Meriones unguiculatus, Mongolische Rennmaus, Mérione de Mongolie. Shaw's jird, Meriones shawi, Shaw-Rennmaus, Mérione de Shaw. ... http://members.tripod.com/SONA_home/SOCIETYOFNEUROSCIENTISTSOFAFRICA.html SOCIETY OF NEUROSCIENTISTS OF AFRICA: H. Gamrani and the group from Marrakesh described the serotinnergic innervation in the semi-desert rodent, Meriones shawi. While ... http://www.petspark.com/advicecentre/default.cfm?id=395&cat2=Species Advice Centre: Scientific name, Meriones shawi. ... The Shaw's jird (Meriones shawi) is about the same size as a rat and looks like a giant version of the Mongolian gerbil. ... http://www.altpet.net/rodents/breeder.html Rodent Breeders URL Listing: Gerbils G11= Brauer's Gerbils, H1= Golden H2= Teddy Bear H3= Siberian H4= European Black Bear H5= Syrian, JD1= Shaw's jirds, (Meriones shawi) JD2= Tunesian ... http://www.apus.ru/site.xp/049051053051124.html APUS.RU | ПодÑ?емейÑ?тво ·ПеÑ?чанки ...: APUS.RU ПодÑ?емейÑ?тво ·ПеÑ?чанки – Gerbillinae. -AdRiver-. ПоиÑ?к. ... http://www.apus.ru/site.xp/049051053053124.html APUS.RU | Род Малые ·пеÑ?чанки – Meriones: ...crassus; ПеÑ?чанка африканÑ?каÑ? Meriones shawi; ПеÑ?чанка Зарудного Meriones zarudnyi; ПеÑ?чанка ... http://211612.homepagemodules.de/topic.php?board=211612&forum=11740835&show=lasttopic The Desert Roses: ...- ... Hallo,. ich habe Meriones shawi grandis. ... Bei Interesse kannst du dich ja melden. Sind Geschwister von Constanzes Meriones shawi grandis. ;). Liebe Grüsse Tanja. ... http://211612.homepagemodules.de/forum.php?board=211612&show=last The Desert Roses: ...- ... 16. Ab Juli 2,1 Meriones shawi abzugeben, MorganLeFey, 0, 13, 08.06.2003 12:38. ... 54. Meriones shawi grandis, Galandriel, 0, 15, 02.06.2003 11:55. ... http://membres.lycos.fr/mhmamouchi/works.htm a- PUBLICATIONS DANS LE SECTEUR DES PMA: ...- ... Hypolipidemic and hypocholesterolemeic effect of argan oil (argania spinosa L.) in meriones shawi raats. Journal of ethnopharmacology, 2003. ... http://www.caucasianrugs.net/dir/Rodents/Jirds/ Jirds - Rodents : Caucasian Rugs: Introduction Shaw's Jird - Meriones shawi looks like a giant Mongolian Gerbil Meriones unguiculatus , but unlike its more common relative it is less likely to ... http://www.chm.ma/biodiversite_nationale/faune.htm CHM Maroc: ...- ... gerbillus Gerbillus henleyi Gerbillus riggenbachi Gerbillus nanus Dipodillus maghrebi Dipodillus somini Pachyuromys duprasi Meriones shawi Meriones libycus ... http://members.nanc.com/~mhaines/gerbil.html Gerbil FAQ: ...include Sundevall's Jird (Meriones crassus), Libyan Jirds (Meriones libycus), but mostly when people say jird they mean Shaw's Jird (Meriones shawi), an almost ... http://people.freenet.de/akbuyken/meriones/eibl.htm Gefangenschaftsbeobachtungen an der Persischen Wüstenmaus ...: ...- ... homologe Instinktbewegung kommt beim Ziesel, beim Eichhörnchen, beim Präriehund (Cynomys lewisi), bei Tattera indica, Dipodomys ingens und Meriones shawi vor ... http://www.tierseiten.com/nagetiere/nagetieresystematik.html Systematik der Nagetiere: ...- ... Art: Meriones meridianus Unterart: Meriones meridianus psammophilus Art: Meriones persicus (Persische Wüstenmaus) Art: Meriones shawi (Shaw-Wüstenmaus) Art ... http://parasite.vetmed.ufl.edu/html/est/Pb/031/031PbF05.html National Center for Biotechnology Information (NCBI) welcome to ...: ...c oxidase subunit II [Gerbil... 102 7e-036 pir||I49426 cytochrome c oxidase II - jird (Meriones shawi)... 100 4e-035 sp|P50678|COX2_BUBDE ... http://parasite.vetmed.ufl.edu/html/est/Pb/004/004PbG06.html National Center for Biotechnology Information (NCBI) welcome to ...: ...oxidase subunit II [Gerbil... 167 6e-041 pir||I49426 cytochrome c oxidase II - jird (Meriones shawi)... 166 1e-040 gnl|NCBI_MITO ... http://www.breederlist.com/animallist.cmdl?categoryid=157 BreederList.Com: ...unguiculatus. Shaw's Jird, Meriones shawi. Photographs on these pages have been used with permission of their copyright holders. All ... http://www.petco.com/pet_care_article.asp?webt=0&tab=&categoryID=13&pettype=NULL&articleID=646 PETCO.com - Where the pets go online: Shaw's Jird: Almost identical in appearance to the Libyan gerbil, Shaw's Jirds (Meriones shawi) are easier and more pleasant to keep. ... http://www.petco.com/pet_care_article.asp?webt=0&tab=&categoryID=13&pettype=NULL&articleID=643 PETCO.com - Where the pets go online: Shaw's Jird Gerbil. Species name: Meriones shawi. Known for: Largest of the pet gerbils; Highly intelligent; Easily trained; Very sociable. Background: ... http://www.ratbehavior.org/pet_rodent_classification.htm Pet Rodent Classification: Gerbillinae: Meriones (Walker's): Mongolian gerbil (Meriones unguiculatus); Shaw's jird (Meriones shawi). Pachyuromys (Walker's): duprasi ... http://www.ameyzoo.co.uk/Caresheets/shaws_jird.htm AmeyZoo Exotic Pets: ...by Mark Amey. What are they? The Shaw's Jird (Meriones shawi) is about the same size as a Rat and looks like a giant version of the Mongolian Gerbil. ... http://www.koelle-zoo.de/archiv/nager/nager/ Kölle-Zoo - Nager und Kleintiere: ...- ... [mehr]. Kaninchen Oryctolagus. Shaws Rennmaus meriones shawi. Sugar Glider petaurus breviceps. [mehr]. Roborowski Zwerghamster phodopus roborovwskii [mehr]. ... http://www.atsbio.com/reference/abt10.html GABA References: Gamrani H (1996) GABA uptake and phenotypic characteristics of the subcommissural ependymocytes of the semi-desertic rodent, Meriones shawi: correlation with ... http://home.t-online.de/home/thom.jaekel/specifi.htm Host Specificity: Gerbillus perpallidus, Cricetidae, Africa. Gerbillus gerbillus, Cricetidae, Africa. Meriones shawi isis, Cricetidae, Africa. Mus musculus, Muridae, Europe. ... http://www.suchnase.de/Hobby/Tiere/more11.html Hobby: Tiere hund katze Gold Hamster Tiere allgemein Infos Foto ...: ...- ... Exotic Fauna -> Vorschau Exotische Nager wie Pferdespringer / Allactaga Tetradactyla, Jaculus Jaculus / Wüstenspringmäuse, Meriones Shawi, Shaw Rennmaus ... http://www.findpetsupplies.com/pets/unusual+pets unusual pets: Shaw's Jird Species name: Meriones shawi Known for: Largest of the pet gerbils Highly intelligent Easily trained Very sociable Background: Shaw's Jirds are ... http://www.findpetsupplies.com/pets/pet%20rat%20supplies&start=120 pet rat supplies: Black Rat Snake Breed Sheet Blue Angel Boa Constrictors Burmese » more » Go To Articles Homepage Shaw's Jird Gerbil Species name: Meriones shawi Known for ... http://www.schulzoo.de/berichte/berichte.php Schulzoo-Leipzig eV: ...- ... Autor: Eva-Maria Ewald, Datum: 14.12.2003, Weiter >>. Shaw's Rennmaus (Meriones shawi). Autor: Kathleen Krusemark, Datum: 30.09.2003, Weiter >>. ... http://www.jcyl.es/jcyl-client/jcyl/cs/apssa/tkContent?idContent=34431 Junta de Castilla y León: ...- ... obesus. Foto 7. Meriones shawi en el microhábitat de Phlebotomus papatasi. Leishmaniasis cutánea urbana, endémica o antroponótica. ... http://www.hut.fi/u/lsarakon/rodlinks.html Pet Rodent Color Genetics Links - Lemmikkijyrsijöiden ...: Siamese Gerbils by Julian Barker a new color variety (ok 2003-05-24) http://www.rodent.demon.co.uk/gerbils/siam.htm. Shaw's Jird - Shawinjirdi Meriones shawi. ... http://www.lyon.inserm.fr/499/equipe2.html U499 Equipe Nº 2: ...- ... HUS-CITHAREL A, LEVILLAIN O, MOREL F: Sites of arginine synthesis and urea production along the nephron of a rodent species, Meriones shawi.. ... http://www.sunanezumi.net/bbs-log/minibbs-3.html ã?™ã?ªä¼?言New: ...ã‚‚ã?—ã€?ラインã?Œã?¯ã?„ã?£ã?¦ã?„ã‚‹ã?®ã?ªã‚‰ã€?ã?¾ã?•ã?Šã?•ã‚“ã?¯ã€? Shaw's Jird å¦å?? Meriones shawi å’Œå?? エジプトスナãƒ?ズミ ... http://goliath.power-guestbook.de/foren/F_0197/cutecast.pl?forum=29&thread=91 Nagerforum: ...- ... Etwas öffter in der Heimtierhaltung kommt seit neuestem die Shawi Rennmaus vor (Meriones shawi) sie ist eher ein Einzelgänger 12 - 14 cm groß sie sind ... http://www.exotictrade.com/showaanbod.php Overzicht van alle advertenties: Aangeboden, Phodopus roborovskii - Roborovski dwerghamster, 25-4-2004, 24. Aangeboden, Meriones shawi shawi - Shawi gerbil, 24-4-2004, 22. ... http://www.mail-archive.com/gerbils@listserv.rice.edu/msg08991.html major updates after 100,000 visitors!: File Format: Unrecognized - View as HTML ... http://www.gerbil-info.nl.com/othertristrami.htm. Meriones shawi grandis (Big Shaw's jird): http://www.gerbil-info.nl.com/othershawiuk.htm. ... http://www.personal.us.es/aldesoto/publicaciones.htm Publicaciones: ...- ... MD, Alvarez de Sotomayor M, Bennani-Kabchi N, Hmamouchi M. Hypolipidemic and hypocholesterolemic effect of argan oil (Argania spinosa L) in Meriones shawi rats ... http://www.indiana.edu/~animal/research/demas_cv.html CISAB | Gregory E. Demas - Curriculum vitae: 33. Demas, GE and Bartness, TJ (1999). Effects of food deprivation and metabolic fuel utilization on food hoarding by jirds (Meriones shawi). ... http://home.wtal.de/ehr/gerbils/links.htm Gerbil links: This list is very complete and informative. Great job done! :-)). Matthew Wright. Shaw's Jirds. Clearly arranged information on Meriones shawi. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: Meriones dahli Meriones hurrianae Meriones libycus Meriones meridianus Meriones persicus Meriones rex Meriones sacramenti Meriones shawi Meriones tamariscinus ... http://www.personalroses.com/resources-personalroses-2/morgan-roses.html morgan roses: Roses ... Der Nachwuchs meiner Meriones shawi gehört mit zu Morgan LeFey's The Clan of Camelot, meiner Hobbyzucht für ... August ... http://web.idrc.ca/en/ev-27595-201-1-DO_TOPIC.html CASE STUDIES FROM THE SOUTH11. Monitoring zoonotic cutaneous ...: The disease is transmitted by a vector of the species Phlebotomus papatasi; the reservoir hosts are rodents, namely Psammomys obesus, Meriones shawi and M ... http://www.angelfire.com/realm2/lex_exotics/sjird.html Shaw's Jird: Scientific name: Meriones shawi Size: 30cm long including tail Lifespan: 4-6 years Natural range: coastal desert regions of North Africa and the Middle East. ... http://www.ehess.fr/centres/koyre/personnes/larabi.htm Yamina Larabi-Abbes: ...- ... [1991] LARABI Y. and NGUYEN-LEGROS J. Morphology, density and distribution of tyrosine hydroxylase immunoreactive cells in the gerbil, Meriones Shawi. ... http://www.museumkoenig.uni-bonn.de/for/dfor_huber_acri.htm Arachnida am Museum Koenig (D): 1m 1f, 2 slides. TUNISIA. host: Meriones shawi. Afrolistrophorus (Amlistrophorus) inca Fain, 1976. 3m 3f, 6 slides. PERU. host: Lestoros inca. ... http://search.centralpets.com/phpscripts/PrintFriendly.php?AnimalNumber=3495 CentralPets.com - Jird - Shaw's Page (Printer Friendly Version): Submit a Photo / More Photos, Common Name: Jird - Shaw's Other Common Name(s): Shaws Jird. Scientific Name: Meriones shawi shawi (Full Taxonomy). Group: Jird. ... http://groups.msn.com/UndergroundOracleII/general.msnw?action=get_message&ID_Message=10869 Underground Oracle II: PM. The Shaw's Jird (Meriones shawi) is about the same size as a rat and looks like a giant version of the Mongolian Gerbil. Indeed ... http://eo.wikipedia.org/wiki/Ron%C4%9Duloj RonÄ?uloj - Vikipedio: ...pÃskomil maloasijský specio : meriono tristrama - Meriones tristrami - pÃskomil Tristramův specio : meriono dezerta - Meriones shawi - pÃskomil Shawův ... http://www.srlst.com/118.htm 118.htm: 143 Historadioautographic localisation of oxytocin and vasopressin binding sites in the central nervous system of the merione {Meriones shawi). ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: CTCAGTTTGTCGCAAGTGAAAACCCCAAGGAGCTTGTCAATGGTTCTAACAATGCTGGAAGTGGCACAGA GTGCTTCAAGCACCCGTTGAGACAGGAGATTAACCACAGTCAGGAGACA >Meriones shawi breast cancer protein ... http://www.zoo.poznan.pl/mysz_sha.htm Myszoskoczka Shawego: MYSZOSKOCZKA SHAWEGO. Meriones Shawi. Shaws Jird; Shaws Rennmaus. Zamieszkuje nory stanowiÄ…ce labirynt korytarzy i komór na nizinnych ob-szarach Afryki PÅ‚n. ... http://masendav.com/archives/2003_07.html anti päewik: juuli 2003 arhiiv: ...http://www.sexualrecords.com. A type of gerbil called Shaw's jird (Meriones shawi shawi) has been observed to copulate 224 times in the space of 2 hours. ... http://www.jeukmic.org/abstr/int/f/f16.HTML [an error occurred while processing this directive] Meriones shawi [an error occurred while processing this directive] 42666 Shaw's Jird Shaw's Jird Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |