|
|
Mus spretus - Algerian MouseIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://bacpac.chori.org/product_info.php?cPath=39_1037_988&products_id=1113 Ordering Page: Product Information. CHORI-35 Mouse SPRET/Ei (M) (Mus spretus) BAC Library: Segment 1 filter set $1,800.00USD, Click here for info ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/Mus_spretus.html ADW: Mus spretus: Classification: Mus spretus (Algerian mouse). Classification. ... Parent taxa. pictures specimens. Genus Mus (Old World mice). Species Mus spretus (Algerian mouse). ... http://animaldiversity.ummz.umich.edu/site/accounts/information/Mus.html ADW: Mus: Classification: ...sorella (Thomas's pygmy mouse). Species Mus spicilegus (mound-building mouse). Species Mus spretus (Algerian mouse). Species Mus tenellus ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=720505 [Hybridization between Mus musculus L. and Mus spretus Lataste ...: ...[Hybridization between Mus musculus L. and Mus spretus Lataste under laboratory conditions (author's transl)] [Article in French] Bonhomme F, Martin S, Thaler L ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Link&db=PubMed&dbFrom=PubMed&from_uid=11598790 Entrez PubMed: Abstract, Developmental instability in a riparian population of the Algerian mouse(Mus spretus) associated with a heavy metal-polluted area in central Portugal. ... http://merops.sanger.ac.uk/speccards/peptidase/sp000007.htm Peptidase of Mus spretus (western wild mouse): Mus spretus (western wild mouse). TAXONOMY. Taxonomy database identifier: 10096. Superkingdom, Eukaryota. Kingdom, Animalia. Subkingdom, Metazoa. Phylum, Chordata. ... http://www.biomedcentral.com/pubmed/11357865 Morphological and haematological parameters in the Algerian mouse ...: Click here to read Morphological and haematological parameters in the Algerian mouse (Mus spretus) inhabiting an area contaminated with heavy metals. ... http://www.biomedcentral.com/pubmed/11179824 Polymorphic electrophile response elements in the mouse ...: Two species, Mus caroli and Mus spretus, showed TGAC-->TGGC mutations in the tandem TGAC motif. Inducibility (15-fold) of the variant ... http://www.lcpackings.com/applications/UltiMate/Proteomics17.htm Proteomics #17: The grassland mouse, Mus spretus, is one such species that lives alongside the house mouse in certain areas of mainland Europe. ... http://bioc09.uthscsa.edu/~hs_lab/frames/publication.html Publications -SC Hardies: Greene-Till R, Zhao Y, and Hardies SC. 2000. Gene flow of unique sequences between Mus musculus domesticus and Mus spretus. Mamm. Genome 11:225-230. ... http://bioc09.uthscsa.edu/~hs_lab/frames/msf/spretstat.html spretus Ms475 and Ms7024 lineages: Mus spretus Ms475 and Ms7024 lineages. Ms475 family. This family ... burst. The Ms475 probe detects 2000 copies in Mus spretus. There ... http://imgt.cines.fr/textes/IMGTrepertoire/LocusGenes/tabgenes/mouse/IGL/IGLV/Mu_IGLV.html IMGT Marie-Paule page: IMGT repertoire: Germline gene table: Mouse (Mus musculus, Mus spretus) IGLV: ... : genomic DNA, but not known as being germline or rearranged. Mouse (Mus spretus) IGLV ... http://imgt.cines.fr/textes/IMGTrepertoire/LocusGenes/tabgenes/mouse/IGL/IGLC/Mu_IGLC.html IMGT Marie-Paule page: IMGT repertoire: Gene and allele table: Mouse (Mus musculus, Mus spretus) IGLC: Fct: FUNCTIONALITY; F: Functional; ... Mouse (Mus spretus) IGLC IGLC subgroup, IGLC gene ... http://www.iec.es/institucio/societats/ICHistoriaNatural/Bages/planes/Imatges%20grans/ratoli.htm Tant el ratolà mediterrani (Mus spretus: Tant el ratolà mediterrani (Mus spretus), que veiem a la foto, com la musaranya comuna (Croccidura russula) són habitants comuns dels marges de pedra dels ... http://www.univ-montp2.fr/~genetix/souris.htm Souris Sauvages: ...- ... CTP. 2. Mus m. castaneus. Thailande : Pathumthani. SEG. 36. Mus spretus. Espagne : Grenade. SFM. 26. Mus spretus. France : Montpellier. SMZ. 11. Mus spretus. Maroc : Azzemour. ... http://www.univ-montp2.fr/~edbi/dea/fiche_stage_archives.php?matricule=5 Fiche de présentation du stage: ...- ... autosomale des chromosomes sexuels s'est accompagné d'une très forte augmentation de son taux de GC par rapport à la situation chez Mus spretus où Fxy est ... http://www.ipa.min-cultura.pt/publicacoes/revista/v1/v1n2/081-084 Faunas de micromamÃferos do Abrigo da Pena d'Ã?gua (Torres Novas) ...: ...- ... De particular interesse paleoecológico e arqueológico é a presença de Mus spretus e Mus musculus, espécies associadas à expansão e desenvolvimento do ... http://www.signaling-gateway.org/molecule/query?afcsid=A001713&type=extrecords&adv=latest Database links for AfCS protein A001713 - Signaling Gateway: Update, Species. GenBank, 4097279, AAD09456.1, -, p16INK4a tumor suppressor protein [Mus spretus], 63, 2, 26 Jan 1999, Mus spretus. TrEMBL, ... http://www.signaling-gateway.org/molecule/query?afcsid=A000099&type=extrecords&adv=latest Database links for AfCS protein A000099 - Signaling Gateway: Mus musculus. PIR, 2143546, -, I49418, insulin I precursor - western wild mouse (fragment), 39, 3, 16 Jul 1999, Mus spretus. GenBank, 497063, ... http://bioinformatics.weizmann.ac.il/databases/embl/align/ds40859.dat ALIGNMENT NO: DS40859 TITLE: LINE-1 sequences exemplifying the ...: U15647 Mmconreg1 Mus musculus domesticus Z13985 Muspr Mus musculus domesticus M23263 L1Md17 Mus musculus domesticus X14061 SHA Mus spretus AF133713 SFA Mus ... http://www.imgs.org/abstracts/2003abstracts/file162.shtml 17th International Mouse Genome Conference (2003): POSTER 114 - THE MUS SPRETUS VARIANT FOR PRKDC GENE, A FULLY DOMINANT ALLELE INVOLVED IN THE GENETIC DETERMINISM OF RESISTANCE TO GAMMA-RADIATION-INDUCED ... http://www.imgs.org/abstracts/99abstracts/montagutelli2.shtml International Mammalian Genome Society 1999 Abstracts: E8 Introgressing Mus spretus Genome into a C57BL/6 Background: Lessons from the Establishment of Interspecific Recombinant Congenic Strains. ... http://www.malariajournal.com/search/results.asp?db=pm&terms=Nunes_AC&field=AU Malaria Journal | Search results Nunes_AC in author: 7. Hepatic elemental contents and antioxidant enzyme activities in Algerian mice (Mus spretus) inhabiting a mine area in central Portugal. ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=Mus+spretus+%5Bgbrod%5D Codon usage table: Mus spretus [gbrod]: 27 CDS's (11370 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 21.9( 249) UCU 13.9( 158 ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=mitochondrion+Mus+spretus+%5Bgbrod%5D Codon usage table: ...mitochondrion Mus spretus [gbrod]: 1 CDS's (116 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 43.1( 5) UCU ... http://www.jax.org/resources/documents/cmdata/bkmap/BSB16refs.html TJL BSB Panel: Chr 16 refs: D16Hun8. Reference: Elango R, Riba L, Housman D, Hunter K, 1996. Generation and mapping of Mus spretus strain-specific markers for rapid genomic scanning. ... http://www.jax.org/resources/documents/cmdata/bkmap/BSB10refs.html TJL BSB Panel: Chr 10 refs: D10Hun6. Reference: Elango R, Riba L, Housman D, Hunter K, 1996. Generation and mapping of Mus spretus strain-specific markers for rapid genomic scanning. ... http://www.roswellpark.org/document.asp?lid=3483&print=true -- Roswell Park Cancer Institute: We have utilized the strongly tumor-resistant Mus spretus species to map several genes that control different stages of skin tumorigenesis. ... http://www.joslinresearch.org/pinet/InvestigatorDetail.asp?InvestigatorID=30 Joslin Investigator Details: The researchers have also been conducting studies breeding the NOD mouse with the Mus spretus, a wild strain of mouse. The researchers ... http://cba.fc.ul.pt/pessoas/mathias/mathias.html CBA, Centro de Biologia Ambiental: ...& ML Mathias. Morphophysiological and biochemical results of lead intoxication in Algerian mice (Mus spretus). 1st International ... http://webdoc.sub.gwdg.de/ebook/w/2002/nock/_index.htm SUB Göttingen - Dissertationen - Nock, Christina Maria: ...- ... Die Untersuchung der Gehirnproteine der beiden Maeusespezies Mus musculus und Mus spretus durch hochaufloesende zweidimensionale Elektrophorese (2-DE) in der ... http://higo.co.jp/gan/5-3.html 戻ã?—交é…?世代を用ã?„ã?ŸæŸ“色体地図ã?®ä½œæˆ?: ...欧米ã?§ã?¯é‡Žç”Ÿãƒžã‚¦ã‚¹ç”±æ?¥ã?®ç³»çµ±ã?«Mus Spretus（スペイン産） を一般的ã?«ä½¿ç”¨ã?—ã?¦ã?„る。 ã?¾ã?Ÿã‚?ã?Œå›½ã?§ã?¯ã€?Mus m . molossinus ... http://www.genlink.wustl.edu/cgi-bin/teldbSearch.pl?sort_by=Date&mode=table&gic=mTR&gic_sl=any TelDB: References found: Last Updated, 5/28/99. Organism, mammal: Mus musculus / Mus spretus [rodent: mouse]. ... Organism, mammal: Mus musculus / Mus spretus [rodent: mouse]. Journal Keywords, ... http://web.bio.utk.edu/humangenetics/MappingProtocol.html BCMB 465 Human Genetics, Mapping Protocol Example: The first mating (the outcross) was of a C57BL/6J (designated B) mouse (Mus musculus musculus) to a Mus spretus (designated S) male. ... http://www.jbc.org/cgi/content/abstract/275/40/31520 JBC -- Abstracts: Dey et al. 275 (40): 31520: When mtDNA-less cells derived from the common mouse (Mus musculus domesticus) were fused to cytoplasts prepared from Mus musculus, Mus spretus, or rat (Rattus ... http://www.jbc.org/cgi/content/abstract/266/19/12715 JBC -- Abstracts: Reue and Leete 266 (19): 12715: ...additional M. domesticus strains examined had four repeat units, as found in C57BL/6. Among wild-derived mice, however, one species (Mus spretus) had three ... http://pci204.cindoc.csic.es/tesauros/Biol_Ani/html/BIO_M5.HTM Tesauro Alfabético Conceptual: ...- ... LT 13 TaxonomÃa y sistemática < RODENTIA .< MICROMAMMALIA ..< MAMMALIA > APODEMUS FLAVICOLLIS > APODEMUS SYLVATICUS > MUS MUSCULUS > MUS SPRETUS MUS MUSCULUS ... http://www.il-st-acad-sci.org/mammals/murids002.html MURINAE: Mus musculoides. Orange mouse, Mus orangiae. Mus spretus. Subgenus Coelomys. Sumatran shrew-mouse, Mus crociduroides. Indian shrew-mouse, Mus famulus. ... http://worm-chip.stanford.edu/telomeres_pubmed.04-13-2003.html Entrez-PubMed: Click here to read Mus musculus and Mus spretus homologues of the human telomere-associated protein TIN2. Kim S, Parrinello S, Kim ... http://bioperl.org/pipermail/bioperl-guts-l/2003-August/014474.html [Bioperl-guts-l] bioperl commit: ...bioperl-live/t/data/D12555.gbk 2003/08/11 19:44:59 1.2 @@ -0,0 +1,47 @@ +LOCUS MUSBC05 105 bp DNA linear ROD 12-APR-2002 +DEFINITION Mus spretus gene for beta ... http://bioperl.org/pipermail/bioperl-l/2003-June/012438.html [Bioperl-l] from protein to nucleotide: SOURCE Mus spretus (western wild mouse) ORGANISM Mus spretus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia ... http://robetta.bakerlab.org/results.jsp?id=979&p=3 Robetta Structure Prediction Server Job 979 Results - NAT2_Human: Description. 10096, Mus spretus, 3 (2.61%), 1E-122, 1-290, 1-290, 439, 75, 290, emb|CAC85419.1|, Arylamine N-acetyltransferase 2 [Mus spretus]. ... http://robetta.bakerlab.org/results.jsp?id=638&p=21 Robetta Structure Prediction Server Job 638 Results - cypin: Guanin... 10096, Mus spretus, 1 (0.07%), 1E-68, 1-454, 1-454, 262, 96, 454, gi|20270696|gb|AAM18374.1|, guanine deaminase [Mus spretus]. 10116, ... http://geta.life.uiuc.edu/RDP/data/SubLUnal/LSU_Unal_alpha.M.html LSU unaligned rRNA Alphabetic List -- "M": Mus_mus5_M Mus musculus; Mus_mus6_M Mus musculus; Mus_spr2_M Mus spretus; Mus_spr3_M Mus spretus; Mus_spre_M Mus spretus; Myb.leprae Mycobacterium leprae. ... http://www.complextrait.org/ctc2002/nagase.html Dominant screening using HIB (Heavy Ion Beam) mutagenesis Combined ...: Thus, a large dominant screening has been performed to more than 300 G1 animals from irradiated Mus spretus G0 males and FVB/N females. ... http://pubs.nrc-cnrc.gc.ca/cgi-bin/rp/rp2_abst_e?gen_g01-157_45_ns_nf_gen2-02 NRC Research Press: Genome: ...- ... SPRET-1. The only codon change resulting in an amino acid substitution was found at nucleotide 523, where GAT was replaced by AAT in Mus spretus resulting in ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180365 ITIS Standard Report Page: Mus: Species, Mus sorella (Thomas, 1909), Species, Mus spicilegus Petenyi, 1882, Species, Mus spretus Lataste, 1883, Species, Mus tenellus (Thomas, 1903), ... http://www.bio.sk/dir/?cat=0&area=0&tax=10088 BIO.SK - Directory: Mus poschiavinus (0). Mus saxicola (0). Mus setulosus (0). Mus sp. (0). Mus spicilegus (0). Mus spretus (0). BIO.SK 2003. biosk@bio.sk. http://www.nih.go.jp/yoken/genebank/MNCb/seq5/MNCb-1886.BLA BLASTN 2.0a2MP-WashU [20-Oct-1996] [Build 22:58:53 Oct 20 1996] ...: ...scoring Segment Pairs: Score P(N) N emb|AF064715|ROD AF064715 Mus musculus domesticus clone M... 1717 1.5e-71 1 emb|AF064718|ROD AF064718 Mus spretus clone S1 ... http://www.genome.gov/10001852 National Human Genome Research Institute - BAC Library Proposals ...: 11/15/01. (Mus m. castenus CAST/Ei). Available. CHORI. 11/15/01. (Mus spretus SPRET/Ei). Available. CHORI. 6/10/02. Mouse, Male (Mus musculus C57BL/6J) Proposal (pdf). ... http://www.biochem.uthscsa.edu/department/refs/hardies_refs.html Hardies SC, PubMed entries: Gene flow of unique sequences between Mus musculus domesticus and Mus spretus. ... Mus spretus LINE-1s in C57BL/6J map to at least two different chromosomes. ... http://parasite.vetmed.ufl.edu/pf/html/0258c3.html National Center for Biotechnology Information (NCBI) welcome to ...: 32 0.70 gi|2271483 (AF009521) sex determining protein [Mus spretus] 32 0.70 emb|CAB11136.1| (Z98551) predicted using hexExon; MAL3P6.15... ... http://www.espairuralgallecs.net/natura.htm Gallecs: La Musaranyeta (Suncus etruscus); El Ratolà de Camp (Mus spretus); La Musaranya Comuna (Crocidura russula); El Ratolà de Bosc (Apodemus sylvaticus). ... http://www.espairuralgallecs.net/castella/natura.htm Gallecs: ...- ... mediterráneas, como: La Musaraña pequeña (Suncus etruscus); El Ratón de Campo (Mus spretus); La Musaraña Común (Crocidura russula); ... http://nar.oupjournals.org/cgi/content/abstract/25/15/3051 Nucl. Acids. Res. -- Abstracts: Coviello-McLaughlin and Prowse 25 ...: University Press. ARTICLES. Telomere length regulation during postnatal development and ageing in Mus spretus. GM Coviello-McLaughlin ... http://nar.oupjournals.org/cgi/content/full/26/21/4960 Nucl. Acids. Res. -- Chiang et al. 26 (21): 4960: Interspecific backcross mapping. The B6xSpret (C57BL/6J × Mus spretus) backcross mapping panels were obtained from Jackson Laboratories. ... http://www.nrtonline.co.yu/zoopage/klas/glodari.htm ZOO-PAGE :: KLASIFIKACIJA :: SISARI :: GLODARI: Mus Spretus. Mus Spretus. Dinaromys Bogdanovi, Dinaromys Bogdanovi. Rattus Rattus. Rattus Rattus. Cricetus Cricetus, Cricetus Cricetus. Pityms Subterraneus. ... http://www.faseb.org/genetics/ashg00/f1849.htm Program Nr: 1849: Most of the markers have been typed against the C57BL/6J x Mus spretus (BSS) interspecific backcross panel (JAX) to anchor them to the existing mouse map and ... http://www.faseb.org/genetics/ashg99/f2444.htm 2444: Xenomitochondrial mouse cell cybrid models of multiple ...: Similar crosses with Rattus norvegicus cells (Mus/Rattus divergence was around 10 mybp) and Mus spretus cells (divergence around 1 mybp) produced cybrids at a ... http://www.iit.edu/~iitnsf/nm97abs.html Chicago AMP-NSF Partnership- New Mexico abstracts: In this project, an interspecific cross between M. domesticus strain C57BL10/J and Mus spretus is being used to accomplish two objectives: (1) To establish ... http://www.iit.edu/~iitnsf/flo96abs.html Chicago AMP-NSF Partnership- Florida abstracts: In this project, an interspecific cross between M. domesticus strain C57BL1OJ and Mus spretus is used to determine the genetic recombination distance between ... http://www.agr.hokudai.ac.jp/anim/breed/ronnbun1.htm 論文発表2001: KW, El-Nahas,A., Ables,GP, Asano,A. and Watanabe,T. Male hybrid sterility of mice with the genomic region Kit w mutation an the Kit s allele from Mus spretus. ... http://www.ermanz.govt.nz/search/application3.cfm?applicationcode=GMC01008 ERMA New Zealand Search - Application Register Search Details: Controls. Mus spretus (Latase) (GMC01008), Mus spretus (animal, vertebrate, mouse, GM, cell line, containment), Approved with Controls. ... http://wwwmgs.bionet.nsc.ru/mgs/gnw/trrd/browse_species.shtml Browse genes by species: Ms, mouse, Mus saxicola. Msp, western wild mouse, Mus spretus. Mst, alfalfa, Medicago sativa L. Mt, annual alfalfa, Medicago truncatula. ... http://www.isem.univ-montp2.fr/GE/Rongeurs/Cassaing.php Jacques CASSAING: ...- ... menées sur le terrain, sont centrées sur trois modèles animaux : le rat noir, Rattus rattus, le mulot, Apodemus sylvaticus, et la souris sauvage, Mus spretus ... http://cogprints.ecs.soton.ac.uk/archive/00000036/00/tins.htm Hippocampal morphology and open-field behavior in Mus musulus ...: Crusio, Wim, E (1996) Gene targeting studies: New Methods, old problems. Trends in Neurosciences 19 186-187. Gene targeting studies: New methods, old problems. ... http://www.allgenes.org/allgenes/servlet?page=rna&id=DT.60118348&view=nrdb allgenes.org | DoTS Transcript DT.60118348: ...construct]. view, XP_148428.2, 2.4e-12, +, RIKEN cDNA 4930451C15 [Mus musculus]. view, AAN52938.1, 3.7e-12, +, NOD2 [Mus spretus]. view, AAK76360 ... http://www.uthscsa.edu/faculty/hardiess.html Stephen C. Hardies, Ph.D.: Rikke, BA, Garvin, LD, and Hardies, SC, Systematic identification of species specificity in LINE-1 repetitive sequencesbetween Mus domesticus and Mus spretus. ... http://www.molvis.org/molvis/v6/a27/lyon-fig1.html Lyon, Mol Vis 2000; 6:199-203. Figure 1.: Figure 1. Chromosome mapping data for Ccw. A. Numbers of offspring typed for Ccw and microsatellite markers in a backcross of Ccw/Mus spretus females. ... http://www.blackwell-synergy.com/links/doi/10.1111/j.1601-5223.1996.00145.x/enhancedabs/ Chromosome markers for Mus macedonicus (Rodentia, Muridae) from ...: Anzahl und Struktur der Chromosomen von Mus spretus Lataste, 1883 (Rodentia, Muridae) von der Iberischen Halbinsel. Säugetierkd. Mitt. 31: 161-169. ... http://www.blackwell-synergy.com/links/doi/10.1046/j.1420-9101.2003.00656.x/enhancedabs/ Divergent genetic and epigenetic post-zygotic isolation mechanisms ...: ..., Elango, R., Riba, L., Housman, D. & Hunter, K. 1996. Generation and mapping of Mus spretus strain-specific markers for rapid genomic scanning. Mamm. ... http://genome.jgi-psf.org/cgi-bin/dispGeneModel.v4?db=ciona4&id=141475 Protein Pages: Ciona intestinalis (Sea Squirt): Best Hit: gi|3024637|sp|Q62563|SRY_MUSSP Sex-determining region Y protein (Testis-determining factor) (model%: 49, hit%: 25, score: 150, %id: 34) [Mus spretus]. ... http://www.es.embnet.org/Doc/ECJ/ECJ-1998-03/imgt.html IMGT: Mus pahari, 8, 9924. Mus saxicola, 1, 1733. Mus sp. 97, 26187. Mus spretus, 10, 4881. Mustela vison, 1, 1547. None, 10, 2813. Oncorhynchus mykiss, 64, 34942. ... http://www2.bioch.ox.ac.uk/~jhe/wcmp/sprm.htm spretus-mus genetic distances: ...spretus-mus genetic distances. Data from Frederick, Jenkins and Copeland. February 1998. Suggestive evidence of small inversions on several autosomes. http://www.ornl.gov/sci/techresources/Human_Genome/publicat/99santa/41.html Genome Sequencing Technologies and Resources Abstracts 1999: SSR polymorphisms (SSRPs) at two mouse genome loci, D4Mit141 and D8Mit9, were identified and compared for Mus musculus (C57/Bl or C3H), Mus spretus, a C57/Bl x ... http://www.bris.ac.uk/Depts/PathAndMicro/services/CGR/MOUSE/Mouse_GenBank/L07575.txt LOCUS MUSINTERB 180 bp DNA ROD 11-AUG-1993 DEFINITION Mus Spretus ...: LOCUS MUSINTERB 180 bp DNA ROD 11-AUG-1993 DEFINITION Mus Spretus interleukin-2 (Il-2) gene, 5' end. ACCESSION L07575 NID g349515 ... http://www.bris.ac.uk/Depts/PathAndMicro/services/CGR/MOUSE/Mouse_GenBank/M24221.TXT LOCUS MUSIL6C 1013 bp DNA ROD 21-JUN-1995 DEFINITION Mus musculus ...: ACCESSION M24221 NID g341131 KEYWORDS IL-6 gene; interleukin; interleukin 6. SOURCE Mus musculus (strain (C57BL/6J x Mus spretus) F1 x C57BL/6J) (clone: pXM-27 ... http://www.nervenet.org/QTL/WildInbreds.html Wild Inbreds: 2.80%. SPRET/Ei, 59,049, ±1,804, ±4,035, 6, 6.80%, I, 54,634, 63,464, 53,323, 64,447, 11,124, ±4,394, 0.64, Mus spretus, 33, 10.2, 336, ±25, 7.60%. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=262560 Characterization of Recombinant Nonecotropic Murine Leukemia ...: 12781 DOI: 10.1128/JVI.77.23.12773-12781.2003 Characterization of Recombinant Nonecotropic Murine Leukemia Viruses from the Wild Mouse Species Mus spretus. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=45983&rendertype=abstract Genetic Analysis of Diabetes and Insulitis in an Interspecific ...: Sci US A. 1993 March 1; 90 (5): 1877 1881 Genetic Analysis of Diabetes and Insulitis in an Interspecific Cross of the Nonobese Diabetic Mouse with Mus spretus. ... http://www.infobiogen.fr/db/genbank/GBfasta/gbsts.seq gb|X95299|AACISTRNA A.alba chloroplast DNA for intergenic spacer ...: GTCGTTCTGTTCGAGTCTGAATTTAAGCGTATTCCAACGAGAAAGAAAACAAAGCTTATG AAGAGACGTGAAGCCGGTCTCCTGCAG >gb|AB004261|AB004261 Mus spretus genomic DNA, RLGS spot, D4Rik141 ... http://www.infobiogen.fr/db/embl/EBfasta_78/sts.seq emb|X95299|AACISTRNA A.alba chloroplast DNA for intergenic spacer ...: GTCGTTCTGTTCGAGTCTGAATTTAAGCGTATTCCAACGAGAAAGAAAACAAAGCTTATG AAGAGACGTGAAGCCGGTCTCCTGCAG >emb|AB004261|AB004261 Mus spretus genomic DNA, RLGS spot, D4Rik141. ... http://www3.oup.co.uk/nar/database/summary/503 IMGT/GENE-DB: ...and TR genes and 1,024 alleles from Homo sapiens, and 702 IG and TR genes and 1,177 alleles from Mus musculus, Mus cookii, Mus pahari, Mus spretus, Mus saxicola ... http://bioinfo.hku.hk/db/imgt/IMGT/speciesStats.lst Species Statistics ...: ...bernacchii 44 20731 Macaca fascicularis 42 21660 Canis familiaris 41 25631 Carcharhinus plumbeus 36 49485 Hydrolagus colliei 36 25826 Mus spretus 34 17780 ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0737-4038&volume=016&issue=09&page=1192 [an error occurred while processing this directive] Mus spretus [an error occurred while processing this directive] 13985 Algerian Mouse Algerian Mouse Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |