|
|
Nassauvia gaudichaudii - Coastal NassauviaIUCN Status: Least ConcernIUCN Species Profile http://web.kadel.cz/skalnicky/kvCard.asp?Id=9416 SkalniÄ?ky - Detaily: SkalniÄ?ky, Nassauvia gaudichaudii (Cass.) Cass. ... ÄŒeleÄ?, ASTERACEAE. Rod druh var. Nassauvia gaudichaudii (Cass.) Cass. Synonyma, Mastigophorus gaudichaudii Cass. ... http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=chloroplast+Nassauvia+gaudichaudii+%5Bgbpln%5D Codon usage table: ...chloroplast Nassauvia gaudichaudii [gbpln]: 1 CDS's (745 codons) fields: [triplet] [frequency: per thousand] ([number]) UUU 73.8 ... http://www.falklandsconservation.com/publications/warrah/warrah14/plants/plants.html Launch of Native Plants survey: ...feltonii Chevreulia lycopodioides Erigeron incertus Gnaphalium affine Hamadryas argentea Lilaeopsis macloviana Nassauvia gaudichaudii Nassauvia serpens ... http://www.falklandsconservation.com/news/news0999.html News from the Falklands September 1999: Although this cannot be rectified now, this situation should not be allowed to reoccur. Coastal Nassauvia (Nassauvia gaudichaudii). ... http://www.falklands.net/FloraAndFaunaPlants.shtml Falklands Network - Falklands flora, geology, birds, seals ...: Montia perfoliata Myosotis arvensis Myosotis discolor Myriophyllum elatinoides Myrteola nummularia Nanodea muscosa Nassauvia gaudichaudii Nassauvia serpens ... http://www.sealionisland.com/ecotourism/research.htm Sea Lion Lodge - Research: Lilaeopsis macloviana) Native Wood-rush (Luzula alopecurus) Teaberry (Myrteola nummularia) Coastal Nassauvia (Nassauvia gaudichaudii)* Beadplant (Nertera ... http://www.wetlands.org/RDB/Ramsar_Dir/UnitedKingdom/6UK012D02.htm Ramsar Sites Database: ...antarcticus. Three of the 12 Falkland endemic plants, Lilaeopsis macloviana, Graphium affine and Nassauvia gaudichaudii, occur. ... http://www.wetlands.org/RDB/Ramsar_Dir/UnitedKingdom/6UK011D02.htm Ramsar Sites Database: ...the Tussac islands. Two of the 12 Falkland endemic plants, Chevreulia lycopodioides and Nassauvia gaudichaudii, occur. The site ... http://robetta.bakerlab.org/taxonomy.jsp?id=908 Robetta Server Job 908 NR PSI-Blast Taxonomy Results: 41612, Nassauvia gaudichaudii, 1 (0.09%), 4E-40, 410-829, 9-482, 168, 14, 505, pir||T13493, NADH2 dehydrogenase (ubiquinone) (EC 1.6.5.3) chain 5 - Nassauvia ... http://www.esi.umontreal.ca/~bourdeav/HH/DB_HH/HTML/HH-II-3/HH-II-3.una.sol.filN.html HH-I-3: 57 nuc ..|UU|C|UUU|UUUUUCACAUAAAGUAUAUA|AAA|UUGAUGA|GAA| --- NAVCPNDHF Nassauvia gaudichaudii chloroplast NADH dehydrogenase (ndhF) gene, --- (2235 bases) |SCO ... http://elib.cs.berkeley.edu/flowers/sci-N.html CalPhotos Plants: Scientific Names [N]: ...- ... (1) Naranjilla sp. (2) Narcissus pseudonarcissus (2) Narthecium californicum (6) Nassauvia gaudichaudii (1) Nassella lepida (1) Nassella pulchra (9) Navarretia ... http://srs.sanger.ac.uk/srs5bin/cgi-bin/wgetz?-id+2keC41L3CcZ+%5Bprints-AccNumber:PR01434%5D+-e Entry Page: TINCTORIA. tt; Q31875 NADH DEHYDROGENASE - BARNADESIA CARYOPHYLLA. tt; Q32671 NADH DEHYDROGENASE - NASSAUVIA GAUDICHAUDII. tt; Q31838 ... http://www.infobiogen.fr/db/acnuc/nbrf/SPECIES Nª RACINE DþK CELLULAR ORGANISMS DþMÿÿÿü BIOTA Ö ...: ...- ... ACOURTIA MICROCEPHALA – LEIBNITZIA E Ã LEIBNITZIA ANANDRIA P. E Ã… MUTISIA E Ç MUTISIA ACUMINATA P/ E É NASSAUVIA E Ë NASSAUVIA GAUDICHAUDII P0 E Ã? ... http://gallica.bnf.fr/Fonds_Tables/009/M0097697.htm [an error occurred while processing this directive] Nassauvia gaudichaudii [an error occurred while processing this directive] 44036 Coastal Nassauvia Coastal Nassauvia Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |