|
|
Orthogeomys heterodus - Variable Pocket GopherIUCN Status: Lower Risk/Near ThreatenedIUCN Species Profile http://animaldiversity.ummz.umich.edu/site/accounts/specimens/Orthogeomys_heterodus.html ADW: Orthogeomys heterodus: Classification: Orthogeomys heterodus (variable pocket gopher). ... variable pocket gopher Orthogeomys heterodus, variable pocket gopher Orthogeomys heterodus. ... http://www.ots.ac.cr/rdmcnfs/datasets/exsrch.phtml?ds=global&qbe=3148 Searching Dataset GLOBAL: ...[BINABITROP]. 4. +,  98%, Caracteristicas fisicas y reproductivas de la taltuza Orthogeomys heterodus (Rodentia, Geomyidae) en Costa Rica. [BINABITROP]. ... http://www.ots.ac.cr/rdmcnfs/datasets/exsrch.phtml?ds=global&qbe=10982 Searching Dataset GLOBAL: ...- ... [BINABITROP]. 36. +,  98%, Comparacion de dos metodos de combate de la taltuza Orthogeomys heterodus (Rodentia, Geomyidae) en Costa Rica. [BINABITROP]. 37. ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Orthogeomys cuniculus. Orthogeomys dariensis. Orthogeomys grandis. Orthogeomys heterodus. Orthogeomys hispidus. Orthogeomys lanius. Orthogeomys matagalpae. ... http://www.chez.com/rodent/Geomyidae/Geomyidae.html Geomyidae: Méxique) -Thomas -1893. Orthogeomys heterodus - Variable pocket gopher - Costa Rica - Peters - 1865. Orthogeomys hispidus - Hispid ... http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=111 ITIS 'Expert(s)' Search results for James L. Patton: Orthogeomys grandis (Thomas, 1893) -- valid -- giant pocket gopher. Orthogeomys heterodus (Peters, 1865) -- valid -- variable pocket gopher. ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=625199 ITIS Standard Report Page: Orthogeomys: Species, Orthogeomys grandis (Thomas, 1893) -- giant pocket gopher, Species, Orthogeomys heterodus (Peters, 1865) -- variable pocket gopher, ... http://www.phthiraptera.org/Mammals/Geomyidae.html Mammals: Geomyidae: Geomydoecus jonesi Price and Emerson, 1971 *. Geomydoecus pygacanthi Price and Hellenthal, 1988 *. Orthogeomys heterodus (Peters, 1865) - Variable Pocket Gopher ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...tropicalis Orthogeomys cavator Orthogeomys cherriei Orthogeomys cuniculus Orthogeomys dariensis Orthogeomys grandis Orthogeomys heterodus Orthogeomys hispidus ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/DangSciu.html Sciuromorphes en danger: Known only from the type locality : Mexico, Oaxaca, Zanatepec, IUCN : En grand danger. Orthogeomys heterodus, Gaufre à poches variable, Variable pocket gopher. ... http://www.public.iastate.edu/~fvalverd/mamiferos.html MAMIFEROS DE LA ESTACION CERRO DE LA MUERTE: ...until 3200 masl), Rheomys underwoodi, Tylomys watsoni (until 2700 masl), Scotinomys teguina, Reithrodontomys sumichasti, , Orthogeomys heterodus (Center of ... http://www.animalinfo.org/country/costa_ri.htm Animal Info - Costa Rica: Talamancan Small-eared Shrew (Cryptotis gracilis). Van Gelder's Bat (Antrozous dubiaquercus). Other: *Variable Pocket Gopher (Orthogeomys heterodus). ... http://bioweb.pasteur.fr/docs/doc-gensoft/bambe/Data/gophers.dna 13 379 # category-list=(3,1,2)* # Geomys personatus ...: TATCAAACTCATCCTTAGATATTGTCCTA Orthogeomys heterodus TGAAGTTTACATCTTAATCCTCCCAGGCTTCGGAATGATTTCTCATATTGTCACTTATTATTCAGGTAAA ... http://www.natureserve.org/infonatura/speciesIndex/Family_Geomyidae_100248_1.htm InfoNatura Species Index: Family Geomyidae: LMTC002050, Orthogeomys grandis Giant Pocket Gopher, G5, Countries: GT, HN, MX, SV. LMTC002060, Orthogeomys heterodus Variable Pocket Gopher, G3, NT, Countries: CR. ... http://www.mavicanet.ru/directory/rus/28539.html Orthogeomys - MavicaNET: Выделить Ñ?айт, Orthogeomys heterodus: Media - English URL: http://animaldiversity.ummz.umich.edu/accounts/orthogeomys/o._heterodus$media.ht. ... http://www.inta.gov.ar/bariloche/ssd/nqn/publicaciones/fauna.htm COMUNICACIONES TECNICAS RECURSOS NATURALES: ...- ... Estimación de la abundancia de la taltuza Orthogeomys heterodus (Rodentia, Geomyidae) y del daño producido en una zona hortÃcola de Costa Rica . 22 p. ... http://www.ots.duke.edu/tropibiojnl/claris/44-2/!RODRI~1.HTM Lista de mamÃferos de Costa Rica: ...- ... Cryptotis jacksoni Woodman 1992. Orthogeomys heterodus Hafner 1991. Orthogeomys underwoodi Hafner 1991. Heteromys oresterus Nowak 1991. ... http://select.biosis.org/cgi-bin/CitedRef.cgi?doc_id=680084 BIOSIS Cited References: G. pinetis G. texensis, Thomomys bottae, T. bulbivorus, T. talpoides, Pappogeomys bulleri, P. castanops, Cratogeomys tylorhinus, Orthogeomys heterodus) that we ... http://www.savci.upol.cz/hlod-1.htm Rodentia - Hlodavci: ...darienský (M.) - Darien Pocket Gopher Orthogeomys grandis (Thomas, 1893) - pytlonoÅ¡ kÅ™eÄ?kovitý - Giant Pocket Gopher Orthogeomys heterodus (Peters, 1865 ... http://www.uaca.ac.cr/acta/2000may/jcorjgar.htm Análisis de las investigaciones en fitoprotección publicadas en ...: ...- ... solanacearum (2), Pseudomonas sp. (1) y Xanthomonas spp. (1). VERTEBRADOS, Orthogeomys heterodus (1). Cuadro 3. Plagas investigadas ... http://bighost.area.ba.cnr.it/srs6bin/wgetz?%5Btaxonomy-ID:87479%5D+-e TAXONOMY:87479 ID : 35664 PARENT ID : 35661 RANK : species GC ID ...: TAXONOMY:87479 ID : 35664 PARENT ID : 35661 RANK : species GC ID : 1 MGC ID : 2 SCIENTIFIC NAME : Orthogeomys heterodus GENBANK COMMON NAME : variable pocket ... http://cariari.ucr.ac.cr/~pejibaye/Bibliografia.htm BibliografÃa: ...- ... Historia natural, evaluación del daño y combate de la taltuza Orthogeomys heterodus (Rodentia, Geomydae) en una zona hortÃcola de Costa Rica. Tesis Mag. Sc. ... http://www.inbio.ac.cr/ecomapas/ACLAP/generalidades.htm Objetivos: ...- ... Sciurus granatensis. Sciurus deppei. Microsciurus alfari. Geomyidae. Orthogeomys heterodus, LR 2. Heteromyidae. Heteromys oresterus, LR 2. Heteromys desmarestianus. ... http://rds.org.hn/forestal/referencias/publicaciones_inter/manejo_integral_de_plagas.shtml Sitio Forestal de Honduras || Referencias || Publicaciones Interna ...: ...- ... 23, Estimación de la abundancia de la taltuza Orthogeomys heterodus (Rodentia, Geomyidae) y del daño producido en una zona hortÃcula de Costa Rica. ... http://industry.ebi.ac.uk/~alan/BioWidget/Taxonomy/tax4.data 1 root 1 2759 Eukaryotae 1 42452 unclassified eukaryotes 2759 ...: 10023 10010 Geomyidae 33553 35661 Orthogeomys 10010 35662 Orthogeomys cavator 35661 35663 Orthogeomys cherriei 35661 35664 Orthogeomys heterodus 35661 35665 ... http://web.catie.ac.cr/informacion/RMIP/rmip54/indice-c.htm Revista "Manejo Integrado de Plagas" -54: ...- ... Estimación de la abundancia de la taltuza Orthogeomys heterodus (Rodentia, Geomyidae) y del daño producido en una zona hortÃcola de Costa Rica. no. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/SYNOM/MAM54SYN.txt PRINTNAME SYNON_NAME ORIG_NM AUTHOR CITATION NOTES Geomys Ascomys ...: Orthogeomys grandis vulcani Nelson and Goldman. Orthogeomys heterodus cartagoensis Goodwin. Orthogeomys heterodus dolichocephalus Merriam. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC2/SQL/2f.txt SQL> @c:\2f.sql NAME PRINTNAME ...: ...gopher. grandis Orthogeomys grandis Large pocket gopher. heterodus Orthogeomys heterodus Variable pocket gopher. NAME PRINTNAME ... http://bioinfo.hku.hk/db/cutg/gbrod.spsum Acomys cahirinus: 2 1 12 8 4 1 4 2 7 11 3 1 6 3 12 2 3 13 2 5 16 2 ...: 2 4 6 14 1 10 3 0 3 1 0 7 2 0 5 4 4 0 1 5 5 0 5 4 2 1 0 4 4 2 0 4 0 7 4 5 0 1 1 7 1 2 1 2 4 4 1 6 6 17 6 12 1 0 2 0 4 Mitochondrion Orthogeomys heterodus: 2 12 ... http://www.virologia.unimi.it/~prea/rodents/lists/vulnerable.html Family: APLODONTIDAE: Red List:VU B1+2c (Baillie, J.) Distribution:Mexico. Orthogeomys heterodus. Red List:VU B1+2ac (Baillie, J.)Distribution:Costa Rica. Pappogeomys alcorni. ... http://www.infobiogen.fr/db/cutg/CUTG/gbrod.spsum Abrothrix jelskii: 1 0 2 1 0 1 0 1 1 4 2 1 1 1 7 0 4 6 0 1 5 0 2 2 ...: 2 4 6 14 1 10 3 0 3 1 0 7 2 0 5 4 4 0 1 5 5 0 5 4 2 1 0 4 4 2 0 4 0 7 4 5 0 1 1 7 1 2 1 2 4 4 1 6 6 17 6 12 1 0 2 0 4 mitochondrion Orthogeomys heterodus: 2 12 ... http://www.zona.ru/directory/ukr/28539.html Orthogeomys - MavicaNET: Виділити Ñ?айт, Orthogeomys heterodus: Media - English URL: http://animaldiversity.ummz.umich.edu/accounts/orthogeomys/o._heterodus$media.ht. ... http://www.lacim.uqam.ca/~chauve/Enseignement/BIF7002/Rapports/Youssef-Nassiri/fichiers/DNA_MT.fasta [an error occurred while processing this directive] Orthogeomys heterodus [an error occurred while processing this directive] 15548 Variable Pocket Gopher Variable Pocket Gopher Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |