|
|
Orthogeomys hispidus - Hispid Pocket GopherIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://animaldiversity.ummz.umich.edu/site/accounts/specimens/Orthogeomys.html ADW: Orthogeomys: Classification: ...variable pocket gopher Orthogeomys heterodus, variable pocket gopher Orthogeomys heterodus, hispid pocket gopher Orthogeomys hispidus. ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=625209 ITIS Standard Report Page: Orthogeomys hispidus: Go to Print Version, Orthogeomys hispidus (LeConte, 1852) Taxonomic Serial No.: 625209. ... Species, Orthogeomys hispidus (LeConte, 1852) -- hispid pocket gopher, ... http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=111 ITIS 'Expert(s)' Search results for James L. Patton: Orthogeomys heterodus (Peters, 1865) -- valid -- variable pocket gopher. Orthogeomys hispidus (LeConte, 1852) -- valid -- hispid pocket gopher. ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Orthogeomys dariensis. Orthogeomys grandis. Orthogeomys heterodus. Orthogeomys hispidus. Orthogeomys lanius. Orthogeomys matagalpae. Orthogeomys thaeleri. ... http://fwie.fw.vt.edu/wcs/051370.HTM Hispid pocket gopher: NAME - Hispid pocket gopher FAMILY - Geomyidae SCIENTIFIC NAME - Orthogeomys hispidus REFERENCES - 2 and 3 District Reference Toledo 2 Belize 2 Cayo 2 Stann ... http://fwie.fw.vt.edu/wcs/bbismamm.htm Mammals - Belize Biodiversity Information System: Pocket Gophers. Family Geomidae. Hispid pocket gopher Orthogeomys hispidus. Pocket Mice. Family Heteromyidae. Gaumer's spiny pocket mouse Heteromys gaumeri ... http://www.chez.com/rodent/Geomyidae/Geomyidae.html Geomyidae: Peters - 1865. Orthogeomys hispidus - Hispid pocket gopher - Yucatan, Guatemala, NO Honduras - Le Conte - 1852. Orthogeomys lanius ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.geomyidae.orthogeomys.html Thumbnails Page, Rodentia Geomyidae Orthogeomys: Taltuza (Orthogeomys grandis), photo by Mark S. Hafner. Hispid pocket gopher (Orthogeomys hispidus), photo by OJ Reichman. (Click ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.mid.rodentia.geomyidae.orthogeomys.hispidus.3.html Image Page, Rodentia Geomyidae Orthogeomys: Rodentia Geomyidae Orthogeomys. Hispid pocket gopher (Orthogeomys hispidus), photo by OJ Reichman. Return to Genus Copyright © 1997 ... http://www.phthiraptera.org/Mammals/Geomyidae.html Mammals: Geomyidae: Geomydoecus davidhafneri Price, Hellenthal and Hafner, 1985. Orthogeomys hispidus (Le Conte, 1852) - Hispid Pocket Gopher Geomydoecus chapini Werneck, 1945. ... http://bioweb.pasteur.fr/docs/doc-gensoft/bambe/Data/gophers.dna 13 379 # category-list=(3,1,2)* # Geomys personatus ...: TATCAAATTCATCATTAGATATTGTCTTA Orthogeomys hispidus TGAGGTTTATATCTTAATCCTCCCAGGCTTCGGTATAATTTCTCATATCGTCACTTATTACTCAGGCAAA ... http://www.conabio.gob.mx/conocimiento/regionalizacion/doctos/rhp_072.html 72. RÃ?O TAMESÃ?: ...- ... los zorrillos Conepatus leuconotus, Mephitis macroura y Spilogale putorius, los roedores Cryptotis mexicana, Orthogeomys hispidus, Peromyscus ochraventer y ... http://www.conabio.gob.mx/conocimiento/regionalizacion/doctos/rhp_092.html 92. RÃ?O LACANTÚN Y TRIBUTARIOS: ...- ... la comadreja Mustela frenata, el coatà Nasua narica nelsoni, el venado cola blanca Odocoileus virginianus, la tusa Orthogeomys hispidus, el tlacuache cuatro ... http://www.ibiologia.unam.mx/cnma/nativos.html MAMIFEROS TERRESTRES NATIVOS DE MEXICO: ...- ... 1905 *. 234.- Orthogeomys grandis (Thomas, 1893). 235.- Orthogeomys hispidus (Le Conte, 1852). 236.- Orthogeomys lanius (Elliot, 1905) *. ... http://maya.ucr.edu/pril/reservas/elcielo/elcielo6.html Reserva de la Biósfera El Cielo: ...- ... colectado 23 especies de roedores, algunos de los cuales son: Peromyscus ochraventer, Neotoma angustapalata, Orthogeomys hispidus, Reithrodontomys megalotis y ... http://www.ambergriscaye.com/fieldguide/bzanimals.html Belize Beasties, Birds, Invertebrates, animals, mammals and more!: Harvest Mouse, Slender, Reithrodontomys g. gracilis. Pocket Gopher, Hispid, Orthogeomys hispidus. Pocket M. Long-tailed Spiny, Heteromys longicaudatus. ... http://www.natureserve.org/infonatura/speciesIndex/Family_Geomyidae_100248_1.htm InfoNatura Species Index: Family Geomyidae: LMTC002060, Orthogeomys heterodus Variable Pocket Gopher, G3, NT, Countries: CR. LMTC002070, Orthogeomys hispidus Hispid Pocket Gopher, G5, Countries: BZ, GT, HN, MX. ... http://www.planeta.com/ecotravel/mexico/parques/qroo.html Parques Nacionales de Mexico/Planeta.com: ...- ... pigra mono aullador, Tamandua mexicana oso hormiguero, Dasypus novemcinctus armadilo, Sciurus yucatanensis ardilla, Orthogeomys hispidus tuza, Peromyscus ... http://www.savci.upol.cz/hlod-1.htm Rodentia - Hlodavci: ...kÅ™eÄ?kovitý - Giant Pocket Gopher Orthogeomys heterodus (Peters, 1865) - pytlonoÅ¡ kostarický - Variable Pocket Gopher Orthogeomys hispidus (Le Conte, 1852 ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...cavator Orthogeomys cherriei Orthogeomys cuniculus Orthogeomys dariensis Orthogeomys grandis Orthogeomys heterodus Orthogeomys hispidus Orthogeomys lanius ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/SYNOM/MAM54SYN.txt PRINTNAME SYNON_NAME ORIG_NM AUTHOR CITATION NOTES Geomys Ascomys ...: Orthogeomys heterodus dolichocephalus Merriam. Orthogeomys hispidus cayoensis Burt. Orthogeomys hispidus chiapensis Nelson and Goldman. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC2/SQL/2f.txt SQL> @c:\2f.sql NAME PRINTNAME ...: COMMON_NM ----- hispidus Orthogeomys hispidus Hispid pocket gopher. ... http://www.aphis.usda.gov/ws/nwrc/is/annpub1995.html DWRC Annual Publications List 1995: 1995. NOTES. Reproductive characteristics of the hispid pocket gopher (Orthogeomys hispidus hispidus) in Veracruz, Mexico. The Southwestern ... http://industry.ebi.ac.uk/~alan/BioWidget/Taxonomy/tax4.data 1 root 1 2759 Eukaryotae 1 42452 unclassified eukaryotes 2759 ...: Orthogeomys 10010 35662 Orthogeomys cavator 35661 35663 Orthogeomys cherriei 35661 35664 Orthogeomys heterodus 35661 35665 Orthogeomys hispidus 35661 35666 ... http://www.bioone.org/bioone/?request=get-document&issn=0022-2372&volume=082&issue=03&page=0652 GETTING WARMER: EFFECT OF GLOBAL CLIMATE CHANGE ON DISTRIBUTION OF ...: Furthermore, of the rodents found in Mexico whose current ranges are 500 km from Texas, only 5 (Tamias dorsalis, Orthogeomys hispidus, Oryzomys fulvescens ... http://www.astronomy.net/forums/god/messages/23232.shtml?&disp=0&disp=0 More (2) - an Astronomy Net God & Science Forum Message: Oropyctis pediasius Oropyctis sp. Orthogeomys grandis Orthogeomys hispidus Orthogeomys onerosus Orthogeomys propinetis Orthogeomys sp. ... http://www.esapubs.org/archive/ecol/E084/093/Mammal_lifehistories_v2.txt order family Genus species mass(g) gestation(mo) newborn(g) ...: 18" Rodentia Geomyidae Geomys arenarius 210.00 -999.00 -999.00 -999.00 -999.00 -999.00 -999 5.00 2.00 26 Rodentia Geomyidae Orthogeomys hispidus 650.00 -999.00 ... http://www.lacim.uqam.ca/~chauve/Enseignement/BIF7002/Rapports/Youssef-Nassiri/fichiers/DNA_MT.fasta [an error occurred while processing this directive] Orthogeomys hispidus [an error occurred while processing this directive] 15549 Hispid Pocket Gopher Hispid Pocket Gopher Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |