|
|
Orthogeomys underwoodi - Underwood's Pocket GopherIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://animaldiversity.ummz.umich.edu/site/accounts/classification/Geomyidae.html ADW: Geomyidae: Classification: ...pocket gopher). Species Orthogeomys underwoodi (Underwood's pocket gopher). Genus Pappogeomys (southern pocket gophers). Species Pappogeomys ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=625213 ITIS Standard Report Page: Orthogeomys underwoodi: Orthogeomys underwoodi (Osgood, 1931) Taxonomic Serial No.: 625213. ... Species, Orthogeomys underwoodi (Osgood, 1931) -- Underwood's pocket gopher, References, ... http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=111 ITIS 'Expert(s)' Search results for James L. Patton: Orthogeomys thaeleri Alberico, 1990 -- valid -- Thaeler's pocket gopher. Orthogeomys underwoodi (Osgood, 1931) -- valid -- Underwood's pocket gopher. ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Orthogeomys lanius. Orthogeomys matagalpae. Orthogeomys thaeleri. Orthogeomys underwoodi. Pappogeomys alcorni. Pappogeomys bulleri. Pappogeomys castanops. ... http://www.chez.com/rodent/Geomyidae/Geomyidae.html Geomyidae: 1900. Orthogeomys underwoodi - Underwood's pocket gopher - Côte Pacifique du Costa Rica - Osgood -1931. Genus hypogeomys. Hypogeomys ... http://www.phthiraptera.org/Mammals/Geomyidae.html Mammals: Geomyidae: Orthogeomys thaeleri Alberico, 1990 - Thaeler´s Pocket Gopher; Orthogeomys underwoodi (Osgood, 1931) - Underwood´s Pocket Gopher ... http://www.natureserve.org/infonatura/speciesIndex/Family_Geomyidae_100248_1.htm InfoNatura Species Index: Family Geomyidae: LMTC002120, Orthogeomys thaeleri Thaeler's Pocket Gopher, G3, Countries: CO. LMTC002110, Orthogeomys underwoodi Underwood's Pocket Gopher, G3, Countries: CR. ... http://www.ots.ac.cr/rdmcnfs/datasets/exsrch.phtml?ds=global&qbe=18135 Searching Dataset GLOBAL: 6. +,  94%, Orthogeomys underwoodi (Rodentia, Geomyidae) on the Osa Peninsula, Costa Rica, with comments on the biological significance of pelage markings in ... http://www.ots.ac.cr/rdmcnfs/datasets/exsrch.phtml?ds=global&qbe=10982 Searching Dataset GLOBAL: ...- ... [BINABITROP]. 47. +,  96%, Orthogeomys underwoodi (Rodentia, Geomyidae) on the Osa Peninsula, Costa Rica, with comments on the biological significance of ... http://bioweb.pasteur.fr/docs/doc-gensoft/bambe/Data/gophers.dna 13 379 # category-list=(3,1,2)* # Geomys personatus ...: TATCAAATTCATCCTTAGATATTATTCTA Orthogeomys underwoodi TGAAGTTTATATCTTGATCCTCCCAGGATTCGGAATGATTTCTCATATTGTCACCTACTATTCAGGTAAA ... http://www.minae.go.cr/especies/index-2.htm Lista de Fauna con Poblaciones Reducidas: ...- ... ardilla del Poás. Sciurus deppei. ardilla. Geomydae. Orthogeomys underwoodi. taltuza. Cricetidae. Oryzomys capito. ratón arrocero. Oryzomys aphrastus. ratón arrocero. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/TAXON/GEOMY.txt ME MYPARENT RORDER NAME TAXON PRINTNAME AUTHOR CITATION COMMON_NM ...: Choco['], Colombia, 100 m. Serrani[']a de Baudo['] (extreme NW Colombia). 20 9 0 underwoodi SPECIES Orthogeomys underwoodi (Osgood, 1931). Field Mus. Nat. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC2/SQL/2f.txt SQL> @c:\2f.sql NAME PRINTNAME ...: ...pocket gopher. underwoodi Orthogeomys underwoodi Underwood's pocket gopher. alcorni Pappogeomys alcorni Alcorn's pocket gopher. NAME ... http://www.rodent.be/rodentfrans/Taxonomie/geomyidae.htm Geomyidae: Orthogeomys lanius. Orthogeomys matagalpae. Orthogeomys thaeleri. Orthogeomys underwoodi. Pappogeomys. Pappogeomys alcorni. Pappogeomys bulleri. Pappogeomys castanops. ... http://www.eeb.cornell.edu/greene/pubs.html Publications: Quarterly Review of Biology 64:225. 71. Greene, HW, and CM Rojas. "1988" [1989]c. Orthogeomys underwoodi (Rodentia, Goemyidae) on the Osa Peninsula, Costa Rica ... http://www.savci.upol.cz/hlod-1.htm Rodentia - Hlodavci: M.) - Nicaraguan Pocket Gopher Orthogeomys thaeleri Alberico, 1990 - pytlonoš Thaelerův (M.) - Thaeler's Pocket Gopher Orthogeomys underwoodi (Osgood, 1931 ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...grandis Orthogeomys heterodus Orthogeomys hispidus Orthogeomys lanius Orthogeomys matagalpae Orthogeomys thaeleri Orthogeomys underwoodi Pappogeomys alcorni ... http://www.ots.duke.edu/tropibiojnl/claris/44-2/!RODRI~1.HTM Lista de mamíferos de Costa Rica: ...- ... Cryptotis jacksoni Woodman 1992. Orthogeomys heterodus Hafner 1991. Orthogeomys underwoodi Hafner 1991. Heteromys oresterus Nowak 1991. ... http://artedi.ebc.uu.se/cfg2000/blast/COB.blastp_nr.html BLASTP 2.0.9 [May-07-1999]: 169 4e-41 gi|4063499 (AF109073) cytochrome b [Erinaceus europaeus] 169 5e-41 gi|642626 (L38466) cytochrome b [Orthogeomys underwoodi] 164 9e-40 gi|4679150|gb ... http://artedi.ebc.uu.se/cfg2000/blast/bI3.blastp_nr.html BLASTP 2.0.9 [May-07-1999]: 169 5e-41 gi|4063499 (AF109073) cytochrome b [Erinaceus europaeus] 169 6e-41 gi|642626 (L38466) cytochrome b [Orthogeomys underwoodi] 164 1e-39 gi|5834877|gnl ... http://industry.ebi.ac.uk/~alan/BioWidget/Taxonomy/tax4.data 1 root 1 2759 Eukaryotae 1 42452 unclassified eukaryotes 2759 ...: ...cavator 35661 35663 Orthogeomys cherriei 35661 35664 Orthogeomys heterodus 35661 35665 Orthogeomys hispidus 35661 35666 Orthogeomys underwoodi 35661 35667 ... http://www.lacim.uqam.ca/~chauve/Enseignement/BIF7002/Rapports/Youssef-Nassiri/fichiers/DNA_MT.fasta [an error occurred while processing this directive] Orthogeomys underwoodi [an error occurred while processing this directive] 42593 Underwood's Pocket Gopher Underwood's Pocket Gopher Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |