Ototylomys phyllotis - Big-Eared Climbing Rat

IUCN Status: Lower Risk/Least Concern
IUCN Species Profile
Florida Entomologist, v. 83, n. 4, p. 487: ...(Diptera: Cuterebridae) infection in Ototylomys phyllotis (Rodentia: Muridae). ... (DIPTERA: CUTEREBRIDAE) INFECTION IN OTOTYLOMYS PHYLLOTIS (RODENTIA: MURIDAE). ...
http://www.chez.com/rodent/Muridae/Muridae.html

Muridae: Otomys sp. - Swamp rat -. Genus Ototylomys. Ototylomys phyllotis- Big-eared climbing rat -. Genus Parotomys. Parotomys littledalei - Karroo rat -. Genus Peromyscus. ...
http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.muridae.ototylomys.html

Thumbnails Page, Rodentia Muridae Ototylomys: Rodentia Muridae Ototylomys (Click on thumbnail to view larger image). Big-eared climbing rat (Ototylomys phyllotis), photo by Lloyd G. Ingles. ...
http://www.press.jhu.edu/books/walkers_mammals_of_the_world/refs/walker.ref-l.html

Literature Cited, L: J. Mamm. 50:28-42. ___. 1982. Ototylomys phyllotis. Mammalian Species, no. 181, 3 pp. Lawrence, B. 1939. Collections from the Philippine Islands. Mammals. ...
http://fwie.fw.vt.edu/wcs/051470.HTM

Big-eared climbing rat: NAME - Big-eared climbing rat FAMILY - Sigmodontinae SCIENTIFIC NAME - Ototylomys phyllotis phyllotis REFERENCES - 3 National abundance, Conservation or ...
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0074-02761999000300005&lng=pt&nrm=iso&tlng=en

Mem s do Instituto Oswaldo Cruz - <B>Use of Monoclonal ...: All the wild rodents (six Ototylomys phyllotis, eight Oryzomys melanotis, five Peromyscus yucatanicus and two Sigmodon hispidus) and 96% (24/25) of the human ...
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0074-02762000000500001&lng=en&nrm=iso&tlng=en

Mem s do Instituto Oswaldo Cruz - <b>Retention of <i>Leishmania ...: ...of the tail. Peromyscus yucatanicus and Ototylomys phyllotis were incriminated as the primary reservoir hosts. The finding that ...
http://www.ecology.info/ecology-ocelot-margay.htm

Ecology of Ocelot and Margay. How these two small cats differ from ...: The Margay ate more arboreal prey than the Ocelot, concentrating on arboreal rodents such as Big-eared Climbing Rats (Ototylomys phyllotis) and Deppe's ...
http://www.scielo.sa.cr/scielo.php?script=sci_abstract&pid=S0034-77441999000100026&lng=en&nrm=iso&tlng=en

Rev. biol. trop vol.47 no.1-2; Abstract: S0034 ...: Six new records are added: Marmosa mexicana, Micronycteris microtis, Micronycteris schmidtorum, Eptesicus furinalis, Rhogeessa parvula, and Ototylomys phyllotis ...
http://botfly.ifas.ufl.edu/links/links1.htm

Links to botfly & related sites: First Record of Cuterebra sp. (Diptera: Cuterebridae) Infection in Ototylomys phyllotis (Rodentia: Muridae) [Report of Cuterebra infestation of big-eared ...
http://www.ots.ac.cr/en/paloverde/species/mammals.shtml

Mammals / Palo Verde: ...- ... Rice Rat. Rata Arrocera. Oryzomys palustris. Rice Rat. Rata Arrocera. Ototylomys phyllotis. Climbing Rat. Rata Trepadora. Sigmodon hispidus. Cotton Rat. Rata Algodonera. ...
http://www.ots.ac.cr/rdmcnfs/datasets/exsrch.phtml?ds=global&qbe=6828

Searching Dataset GLOBAL: ...- ... 24. -, &nbsp88%, Movimientos y seleccion de micro-habitat de una rata arboricola Ototylomys phyllotis (Rodentia: Muridae) en un bosque seco tropical. ...
http://www.bioone.org/bioone/?request=get-citation-links&doi=0015-4040(2000)083%3C0487:FROCSD%3E2.0.CO;2&id=I0022-3395-089-04-0693-MANRIQUESAIDE1&sitename=BIOONE

Citation Links: ...sp. (Diptera: Cuterebridae) infection in Ototylomys phyllotis (Rodentia: Muridae) Florida Entomologist 2000 vol. 83, page 487. This ...
http://www.bioone.org/bioone/?request=get-citation-links&doi=0015-4040(2000)083%3C0487:FROCSD%3E2.0.CO;2&id=I0015-4040-085-02-0369-MANRIQUESAIDE1&sitename=BIOONE

Citation Links: ...sp. (Diptera: Cuterebridae) infection in Ototylomys phyllotis (Rodentia: Muridae) Florida Entomol. 2000 vol. 83:, page 487. This ...
http://www.fmnh.helsinki.fi/users/haaramo/Metazoa/Deuterostoma/Chordata/Synapsida/Eutheria/Rodentia/Myomorpha/Cricetidae.htm

Cricetidae: T. tumbalensis ()? T. watsoni ()? Ototylomys phyllotis (isokorvakiipijärotta) Xenomys nelsoni (magdalenarotta) Geoxus ()? ?G. michaelseni ()? ...
http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas

Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: AACCCCAAGGATCTGGCTCACGGTTCTAATGATGCTGGAAGTAGCACAGAGTGTGTCAAGCATCAGTTGA GACAGGAACTCGGC >gi|34766339|gb|AY295018.1| Ototylomys phyllotis breast cancer protein 1 ...
http://www.birdlist.org/biodiversity/mammals/allmammals/mammallist5.htm

Mammallist5: RODENTIA, Muridae, Otonyctomys, hatti, Anthony, 1932. RODENTIA, Muridae, Ototylomys, phyllotis, Big-eared Climbing Rat, Merriam, 1901. RODENTIA, ...
http://www.worldwildlife.org/wildworld/profiles/terrestrial/nt/nt0303_full.html

Terrestrial Ecoregions -- Central American pine-oak forests ...: ...and Bauerus dubiaquercus), Mexican mouse opposum, (Marmosa mexicana), rodents (Liomys pictus, Microtus guatemalensis, Ototylomys phyllotis, Peromyscus aztecus ...
http://cstl-csm.semo.edu/journet/Inocentesweb/Mammals.htm

Los Inocentes Mammal List: ...not listed. Sigmodon hispidus. Hispid Cotton Rat. + not listed. Ototylomys phyllotis. Big-eared Climbing Rat. 25:3, 209. Nyctomys sumichrasti. Vesper Rat. 25:5, 209. ...
http://www.mavicanet.ru/directory/eng/28692.html

Big-eared Climbing Rats (Ototylomys) - MavicaNET: Select site, Ototylomys phyllotis (Big-Eared Climbing Rat): Narrative - English URL: http://animaldiversity.ummz.umich.edu/accounts/ototylomys/o._phyllotis.html. ...
http://xoomer.virgilio.it/medicine/pathoprotozoa.htm

Homo sapiens diseases - Protozoa: Leishmania mexicana mexicana Transmission : reservoirs : Ototylomys phyllotis , Heteromys desmarestianus , Nyctomys sumichrasti , Sigmodon hispidus ; vector ...
http://www.jcyl.es/jcyl-client/jcyl/cs/apssa/tkContent?idContent=34431

Junta de Castilla y León: ...- ... En la península del Yucatán varios roedores actúan como reservorios, entre otros Ototylomys phyllotis como principal y Heteromys sp., Nyctomys sp. ...
http://memorias.ioc.fiocruz.br/943/3549re.html

RESULTS (Use of Monoclonal Antibodies for the Identification of ...: Between February 1993 and March 1994, 21 strains were isolated from four species of wild rodents: six Ototylomys phyllotis Merriam, 1901; eight O. melanotis ...
http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/msiaccounts.html

Mammalian Species Accounts: Handley's Long-tongued Bat (Anoura cultrata); Rock Vole (Microtus Chrotorrhinus); Big-eared Climbing Rat (Ototylomys phyllotis); Asian ...
http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/msigenus.html

Virginia Hayssen: Rat palustris, 176, Marsh Rice Rat. Ototylomys phyllotis, 181, Big-eared Climbing Rat Peromyscus alstoni, 242, Volcano Mouse attwateri ...
http://www.ibiologia.unam.mx/cnma/nativos.html

MAMIFEROS TERRESTRES NATIVOS DE MEXICO: ...- ... 324.- Otonyctomys hatti Anthony, 1932. 325.- Ototylomys phyllotis Merriam, 1901. 326.- Peromyscus aztecus (Saussure, 1860). 327.- Peromyscus boylii (Baird, 1855). ...
http://www.ibiologia.unam.mx/cnma/lista.html

LISTA TAXONOMICA DE LOS MAMIFEROS TERRESTRES DE MEXICO: ...- ... banderanus banderanus (JA Allen, 1897) Osgoodomys banderanus vicinor (Osgood, 1904) Otonyctomys hatti Anthony, 1932 Ototylomys phyllotis Merriam, 1901 ...
http://www.savci.upol.cz/hlod-4.htm

Rodentia - Hlodavci: ...yucatánský - Hatt's Vesper Rat. Ototylomys phyllotis Merriam, 1901 - kÅ™eÄ?ek uÅ¡atý - Big-eared Climbing Rat. Oxymycterus akodontius Thomas ...
http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html

Classification des Rodentiens: ...subflavus Oryzomys talamancae Oryzomys xantheolus Oryzomys yunganus Osgoodomys banderanus Otonyctomys hatti Ototylomys phyllotis Oxymycterus akodontius ...
http://www.emporia.edu/biosci/msl/rodent.htm

MSL, Order Rodentia: J Visser Ototylomys phyllotis - Big-eared climbing rat - Central America; 553 Profile of caged animal, The Museum, Michigan State Univ., MI, USA, 1980. CS St. ...
http://www.lshtm.ac.uk/dcvbu/students/pablo_manrique-saide.htm

Manrique-Saide Pablo: 2000. First record of Cuterebra sp (Diptera: Cuterebridae) infection in Ototylomys phyllotis (Rodentia: Muridae). Florida Entomologist. 83(4): 487-488. ...
http://www.ots.duke.edu/tropibiojnl/claris/44-2/!RODRI~1.HTM

Lista de mamíferos de Costa Rica: ...- ... Tylomys watsoni X x - - - X* x. Ototylomys phyllotis - x x x - - -. ... Orthogeomys cavator Ototylomys phyllotis. Oryzomys concolor Reithrodontomys gracilis. ...
http://www.ecologia.info/jaguatirica.htm

Ecologia da Jaguatirica e do Gato-Maracajá - Natureza do Brasil.: ...- ... alimentavam mais de presas arbóreas do que as jaguatiricas, que se concentravam mais em roedores arbóreos como os ratos-do-monte (Ototylomys phyllotis) e os ...
http://www.ecologia.info/ocelote-margay.htm

Ecología del Ocelote y el Margay - Naturaleza de Gatos y Felinos.: ...- ... presas arbóreas que los ocelotes concentrándose en roedores arbóreos, tales como las ratas trepadores de orejas grandes (Ototylomys phyllotis) y ardillas ...
http://www.zona.ru/directory/rus/28692.html

Ototylomys - MavicaNET: Ototylomys phyllotis (Big-Eared Climbing Rat): Narrative - English URL: http://animaldiversity.ummz.umich.edu/accounts/ototylomys/o._phyllotis.html. ...
http://www.natureserve.org/infonatura/speciesIndex/Family_Muridae_147_6.htm

[an error occurred while processing this directive] Ototylomys phyllotis [an error occurred while processing this directive] 15666
Big-Eared Climbing Rat Big-Eared Climbing Rat

Home | Search | About


Copyright SpeciesList.com 2003-2009