|
|
Pappogeomys bulleri - Buller's Pocket GopherIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://animaldiversity.ummz.umich.edu/site/accounts/classification/path/Pappogeomys_bulleri.html.html ADW: Pappogeomys bulleri: Classification: Pappogeomys bulleri (Buller's pocket gopher). Classification. What do these icons mean? ... Species Pappogeomys bulleri (Buller's pocket gopher). ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=625215 ITIS Standard Report Page: Pappogeomys bulleri: Go to Print Version, Pappogeomys bulleri (Thomas, 1892) Taxonomic Serial No.: 625215. ... Species, Pappogeomys bulleri (Thomas, 1892) -- Buller's pocket gopher, ... http://www.itis.usda.gov/servlet/SingleRpt/RefRpt?search_type=expert&search_id=expert_id&search_id_value=111 ITIS 'Expert(s)' Search results for James L. Patton: Pappogeomys alcorni Russell, 1957 -- valid -- Alcorn's pocket gopher. Pappogeomys bulleri (Thomas, 1892) -- valid -- Buller's pocket gopher. ... http://www.bioone.org/bioone/?request=get-document&issn=0076-3519&volume=717&issue=01&page=0001 <GENSP>Pappogeomys bulleri</GENSP>: Pappogeomys bulleri. Ana Soler-Frost, Rodrigo A. Medellín, and Guy N. Cameron. ... Pappogeomys bulleri Merriam, 1895 :146. First use of current name combination. ... http://www.bioone.org/bioone/?request=cite-builder&doi=10.1043%2F0076-3519(2003)717%3C0001:PB%3E2.0.CO%3B2 BioOne: Citation Formats: <GENSP>Pappogeomys bulleri</GENSP>: BioOne House Ad 2. BioOne Reference Formats. Soler-Frost, Ana, Medellín, Rodrigo A., Cameron, Guy N. Pappogeomys bulleri Mammalian Species 2003 717: 1-3. ... http://www.interaktv.com/mammals/Rodent.html Biologybase: Mammals of the World: Rodentia: Orthogeomys thaeleri. Orthogeomys underwoodi. Pappogeomys alcorni. Pappogeomys bulleri. Pappogeomys castanops. Pappogeomys fumosus. Pappogeomys gymnurus. ... http://www.chez.com/rodent/Geomyidae/Geomyidae.html Geomyidae: Pappogeomys alcorni - Alcorn's pocket gopher - Sierra del Tigre - Russel - 1957. Pappogeomys bulleri - Buller's pocket gopher - Jalisco - Thomas - 1852. ... http://www.phthiraptera.org/Mammals/Geomyidae.html Mammals: Geomyidae: Geomydoecus alcorni Price and Emerson, 1971 *. Pappogeomys bulleri (Thomas, 1892) - Buller´s Pocket Gopher Geomydoecus bulleri Price and Emerson, 1971 *. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.geomyidae.pappogeomys.html Thumbnails Page, Rodentia Geomyidae Pappogeomys: Rodentia Geomyidae Pappogeomys (Click on thumbnail to view larger image). Buller's pocket gopher (Pappogeomys bulleri), photo by Lloyd G. Ingles. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.mid.rodentia.geomyidae.pappogeomys.bulleri.1.html Image Page, Rodentia Geomyidae Pappogeomys: Rodentia Geomyidae Pappogeomys. Buller's pocket gopher (Pappogeomys bulleri), photo by Lloyd G. Ingles. Return to Genus Copyright ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: ...hispidus Orthogeomys lanius Orthogeomys matagalpae Orthogeomys thaeleri Orthogeomys underwoodi Pappogeomys alcorni Pappogeomys bulleri Pappogeomys castanops ... http://www.natureserve.org/infonatura/speciesIndex/Family_Geomyidae_100248_1.htm InfoNatura Species Index: Family Geomyidae: LMTC003010, Pappogeomys alcorni Alcorn's Pocket Gopher, G3G4, VU, Countries: MX. LMTC003020, Pappogeomys bulleri Buller's Pocket Gopher, G3, Countries: MX. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/SYNOM/MAM54SYN.txt PRINTNAME SYNON_NAME ORIG_NM AUTHOR CITATION NOTES Geomys Ascomys ...: Pappogeomys Platygeomys Merriam. Pappogeomys bulleri albinasus Merriam. Pappogeomys bulleri amecensis Goldman. Pappogeomys bulleri burti Goldman. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC2/SQL/2f.txt SQL> @c:\2f.sql NAME PRINTNAME ...: COMMON_NM ----- bulleri Pappogeomys bulleri Buller's pocket gopher. ... http://www.ibiologia.unam.mx/ebchamela/www/mamiferos.htm Orden: ...- ... Xenomys nelsoni, 65, Rata arborícola, Magdalena rat, Herbívoro. . Geomyidae, 1, Pappogeomys bulleri burti, 66, Tuza, Pocket gopher, Herbívoro. . ... http://www.ibiologia.unam.mx/cnma/nativos.html MAMIFEROS TERRESTRES NATIVOS DE MEXICO: ...- ... 237.- Pappogeomys alcorni Russell, 1957 *. 238.- Pappogeomys bulleri (Thomas, 1892) *. 239.- Pappogeomys neglectus (Merriam, 1902) *. ... http://members.tripod.com/rodentvzw/rodentfrans/Taxonomie/geomyidae.htm Geomyidae: Orthogeomys thaeleri. Orthogeomys underwoodi. Pappogeomys. Pappogeomys alcorni. Pappogeomys bulleri. Pappogeomys castanops. Pappogeomys fumosus. Pappogeomys gymnurus. ... http://www.worldwildlife.org/wildworld/profiles/terrestrial/nt/nt0230_full.html Terrestrial Ecoregions -- Southern Pacific dry forests (NT0230): ...curasoae yerbabuenae), greater fishing bat (Noctilio leporinus) , coati (Nasua narica), Buller’s pocket gopher (Pappogeomys bulleri), javelina (Tayassu tajacu ... http://www.biology.uc.edu/faculty/cameron/cameronpubs.htm Guy N. Cameron: Soler-Frost, A., RA Medellin, and GN Cameron. 2003. Pappogeomys bulleri. Mammalian Species 717:1-3. Liu, AJ, and GN Cameron. 2001. ... http://select.biosis.org/cgi-bin/CitedRef.cgi?doc_id=680084 BIOSIS Cited References: ...of pocket gophers (Geomys bursarius, G. personatus, G. pinetis G. texensis, Thomomys bottae, T. bulbivorus, T. talpoides, Pappogeomys bulleri, P. castanops ... http://bioweb.pasteur.fr/docs/doc-gensoft/bambe/Data/gophers.dna 13 379 # category-list=(3,1,2)* # Geomys personatus ...: TATTCAACTCATCATTAGATATTGTATTA Pappogeomys bulleri TGAAGTTTATATTTTAATTCTCCCAGGTTTCGGAATAATTTCACATATCGTAACCTATTATTCTGGTAAA ... http://www.savci.upol.cz/hlod-1.htm Rodentia - Hlodavci: Pappogeomys alcorni Russell, 1957 - pytlonoš Alcornův - Alcorn's Pocket Gopher Pappogeomys bulleri (Thomas, 1892) - pytlonoš Bullerův - Buller's Pocket ... http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/msiaccounts.html Mammalian Species Accounts: Accounts 715 - 738 Year 2003 top of page. Black-backed Jackal (Canis mesomelas); Montane Vole (Microtus montanus); Buller's Pocket Gopher (Pappogeomys bulleri); ... http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/msigenus.html Virginia Hayssen: Gopher. Pappogeomys bulleri, 717, Buller's Pocket Gopher castanops, 338, Yellow-faced Pocket Gopher tylorhinus, 433, Tuza Ilanera. ... http://www.astronomy.net/forums/god/messages/23232.shtml?&disp=0&disp=0 More (2) - an Astronomy Net God & Science Forum Message: Pantolestes intermedius Pantolestes longicaudus Pantolestes natans Pantolestes phocipes Pantolestes sp. Pappogeomys alcorni Pappogeomys bulleri Pappogeomys sp. ... http://bioinfo.hku.hk/db/cutg/gbrod.spsum Acomys cahirinus: 2 1 12 8 4 1 4 2 7 11 3 1 6 3 12 2 3 13 2 5 16 2 ...: 12 0 6 9 0 4 7 0 2 2 0 12 6 0 6 5 1 1 0 4 10 0 2 3 3 1 1 7 2 0 1 3 0 4 5 4 0 2 1 7 1 3 1 2 4 5 0 11 4 13 6 5 1 0 2 0 4 Mitochondrion Pappogeomys bulleri: 3 23 ... http://www.infobiogen.fr/db/cutg/CUTG/gbrod.spsum Abrothrix jelskii: 1 0 2 1 0 1 0 1 1 4 2 1 1 1 7 0 4 6 0 1 5 0 2 2 ...: 12 0 6 9 0 4 7 0 2 2 0 12 6 0 6 5 1 1 0 4 10 0 2 3 3 1 1 7 2 0 1 3 0 4 5 4 0 2 1 7 1 3 1 2 4 5 0 11 4 13 6 5 1 0 2 0 4 mitochondrion Pappogeomys bulleri: 3 23 ... http://www.lacim.uqam.ca/~chauve/Enseignement/BIF7002/Rapports/Youssef-Nassiri/fichiers/DNA_MT.fasta [an error occurred while processing this directive] Pappogeomys bulleri [an error occurred while processing this directive] 16024 Buller's Pocket Gopher Buller's Pocket Gopher Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |