Phacochoerus aethiopicus - Desert Warthog, Phacochère Du Dèsert, Phacochère Oriental

IUCN Status: Lower Risk/Least Concern
IUCN Species Profile
ADW: Phacochoerus aethiopicus: Information: Phacochoerus aethiopicus (desert warthog). ... Family: Suidae. Subfamily: Phacochoerinae. Genus: Phacochoerus. Species: Phacochoerus aethiopicus. Geographic Range. ...
http://animaldiversity.ummz.umich.edu/site/accounts/classification/Phacochoerus_aethiopicus.html

ADW: Phacochoerus aethiopicus: Classification: Phacochoerus aethiopicus (desert warthog). Information; Pictures; Specimens; Classification. ... Species Phacochoerus aethiopicus (desert warthog). ...
http://www.lostworldarts.com/africa/warthog2.htm

Portrait of a Warthog (Phacochoerus aethiopicus). Samburu National ...: Portrait of a Warthog. Phacochoerus aethiopicus. Photographed in Samburu National Park, Kenya. #M048-33. © Karl Lehmann. NEXT IMAGE, BACK. AFRICA GALLERY. ...
http://www.lostworldarts.com/africa/warthog1.htm

Warthog, Phacochoerus aethiopicus. Photographed in Samburu ...: ...photograph. NEXT IMAGE, Warthog (Phacochoerus aethiopicus). Photographed in Samburu National Park, Kenya © Karl Lehmann. #M049-13. This ...
http://magazine.naturecom.de/text/warthog.html

Warthog (Phacochoerus aethiopicus) - picture and info: Infos about the Warthog (Phacochoerus aethiopicus), a pig species inhabiting the African savannas. With picture of a Warthog. back to index, search site. ...
http://sailfish.exis.net/~spook/warttxt.html

Warthog: WARTHOG, Phacochoerus aethiopicus. WHAT IT IS. Naked swine of the savanna. Slimmer than other hogs, with level back and comparatively long limbs. ...
http://www.redlist.org/search/details.php?species=16790

IUCN Red List of Threatened Species - Phacochoerus aethiopicus ssp ...: Phacochoerus aethiopicus ssp. aethiopicus. Taxonomy. ... Citation: Pigs & Peccaries Specialist Group 1996. Phacochoerus aethiopicus ssp. aethiopicus. In: IUCN 2003. ...
http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=625007

ITIS Standard Report Page: Phacochoerus aethiopicus: Go to Print Version, Phacochoerus aethiopicus (Pallas, 1766) Taxonomic Serial No.: 625007. ... Species, Phacochoerus aethiopicus (Pallas, 1766) -- desert warthog, ...
http://www.natur-lexikon.com/Texte/MZ/001/00064-Warzenschwein/MZ00064-Warzenschwein.html

Natur Lexikon Warzenschwein Phacochoerus aethiopicus: ...- Warzenschwein (Phacochoerus aethiopicus). Gattung: Warzenschweine (Phacochoerus) Familie Echte Schweine (Suidae) Ordnung Paarhufer ...
http://www.animals-online.be/hoofed_mammals/varkens/warthog.html

Warthog (Phacochoerus aethiopicus): Fact Sheet: Scientific name. Phacochoerus aethiopicus. English name. Warthog. Nederlandse naam. Afrikaans wrattenzwijn. Nom Français. phacochère. Deutsche name. Warzenschwein. ...
http://www.tierenzyklopaedie.de/tiere/warzenschwein.html

Warzenschwein Phacochoerus aethiopicus: ...- ... Gattung: Phacochoerus (Warzenschweine). Art: Phacochoerus aethiopicus. Verbreitung: Afrika südlich der Sahara mit Ausnahme der Waldgebiete. ...
http://www.tierenzyklopaedie.de/karten/waschwein.html

Warzenschwein Phacochoerus aethiopicus: ...- Verbreitungsgebiet des Warzenschweins. Das Warzenschwein findet sich in ganz Afrika südlich der Sahara mit Ausnahme der Waldgebiete. ...
http://www.jww.de/artikelbeitrag/artikelbeitrag_13318.html

JAGEN WELTWEIT: Warzenschwein <i>Phacochoerus aethiopicus</i> ...: ...- Praxistipps, - Trense. Warzenschwein Phacochoerus aethiopicus (Pallas, 1767). English: Warthog; French: Phacochère; Acholi: Kul; Amharic ...
http://naturaleza.tripod.com.ar/espanol/animales/facoquero.htm

Facoquero (Phacochoerus aethiopicus) - Naturaleza.com.ar: ...- Tripod provisto por Cable & Wireless. FACOQUERO (Phacochoerus aethiopicus). Género: Phacochoerus. Descripción: Altura en la cruz 80 cm. Peso 140 kg. ...
http://www.punchstock.com/stock_photography/digital_vision/3351511/image_426008.html

PunchStock.com-- stock photo of: Warthog (Phacochoerus aethiopicus ...: Warthog (Phacochoerus aethiopicus), Kruger National Park, South Africa Image: 426008 (View Large Comp in New Window - 426008). Brand: Digital Vision. ...
http://www.punchstock.com/stock_photography/digital_vision/cd_3351511.html

Animal Faces (Digital Vision) in PunchStock.com's collection of ...: Pteropus scapulatus). Digital Vision - 426008: Warthog (Phacochoerus aethiopicus), Kruger National Park, South Africa. Digital Vision ...
http://www.ecotravel.co.za/Guides/Wildlife/Vertebrates/Mammals/Large/Warthog.htm

The Warthog - Phacochoerus aethiopicus of Southern Africa: A Guide to the: Warthog - Phacochoerus aethiopicus. Warthogs, with their conspicuous facial 'warts' and large tusks, have had many ...
http://home.vicnet.net.au/~neils/africa/warthog.htm

Warthog - Phacochoerus aethiopicus - African Safari, July 1999: HOME Warthog (Phacochoerus aethiopicus) photo ©Neil Shedden I took the photo above, in the grounds of the Chobe Safari Lodge campsite. ...
http://library.thinkquest.org/11234/warthog.html

The Wild Habitat - Warthog (Phacochoerus aethiopicus): Warthog Phacochoerus aethiopicus. Top Speed: 30 mph. Status: The population is stable. Picture of a Warthog Picture from ZooNet. Physical ...
http://www.faunistik.net/BSWT/MAMMALIA/UNGULATA/SUIDAE/PHACOCHOERUS/phacochoerus_aethiopicus_01.html

Suidae: Phacochoerus aethiopicus - Warzenschwein: ...- Merkmale des Warzenschweins - Phacochoerus aethiopicus (Bestimmungsübungen an Voegeln und Saeugern). ... Phacochoerus aethiopicus (Pallas, 1767). ...
http://www.faunistik.net/BSWT/MAMMALIA/UNGULATA/SUIDAE/PHACOCHOERUS/phacochoerus_aethiopicus_im01.html

Suidae: Phacochoerus aethiopicus - Warzenschwein: ...- Bestimmungsübungen an Vögeln und Säugern. Last modified: 28.06.02.
http://pigtrop.cirad.fr/fr/petits_curieux/SV_classification_Paethiopicus.htm

Phacochère du désert (Phacochoerus aethiopicus) - PigTrop: ...- LE PHACOCHERE DU DESERT | • Phacochoerus aethiopicus. ... Auteur: Pallas, 1766. Sous-espèces: 2: Phacochoerus aethiopicus aethiopicus, Phacochère du Cap (éteint); ...
http://1kai.dokkyomed.ac.jp/mammal/jp/species/phacochoerus_aethiopicus.html

イボイノシシ: Phacochoerus aethiopicus Wart Hog イボイノシシ 分類. 目:Artiodactyla (Even-toed Ungulates, �蹄目) 科:Suidae ...
http://1kai.dokkyomed.ac.jp/mammal/jp/species_all/phacochoerus_aethiopicus.html

Phacochoerus aethiopicus: Phacochoerus aethiopicus Wart Hog イボイノシシ 分類. 目:Artiodactyla(Even-toed Ungulates, �蹄目) 科:Suidae(Pigs ...
http://www.barry.pearson.name/photography/pictures/k94/k94_06_35_3.htm

Warthog, Phacochoerus aethiopicus: What? Warthog, Phacochoerus aethiopicus. Where? Kenya, Africa. When? 1994. Page last updated: 6 October, 2003, Home page, © Copyright Barry Pearson 2003.
http://www.barry.pearson.name/photography/pictures/k94/k94_06_35_1.htm

Warthog, Phacochoerus aethiopicus: ...mount itself. Subject, What, Warthog, Phacochoerus aethiopicus. Location, Kenya, 1994. Original, Material, Kodachrome 35mm slide. Pre-web, ...
http://www.fotosearch.com/DGV179/426008/

Pictures of Warthog (Phacochoerus aethiopicus), Kruger National ...: Warthog (Phacochoerus aethiopicus), Kruger National Park, South Africa by Digital Vision. Fotosearch Stock Photography helps you find the perfect photo, fast! ...
http://www.fotosearch.com/IMG304/01015020/

Stock Photography of Warthog or Phacochoerus Aethiopicus Africanus ...: Warthog or Phacochoerus Aethiopicus Africanus by image100. ... Warthog or Phacochoerus Aethiopicus Africanus. 01015020 (image100 Royalty Free) ...
http://www.omne-vivum.com/b/3561.htm

genus Phacochoerus- -: Phacochoerus,Phacochoerus aethiopicus, Wrattenzwijn, Wart hog,
http://www.africaelephants.com/gallery/warthog.htm

picture of African warthog (Phacochoerus aethiopicus) found at ...: Warthog (Phacochoerus aethiopicus) found at Tembe Elephant Park in open grassland, often near water, avoiding thick bush or forest. ...
http://www.mukiwasafaris.com/html/edu_warthog.html

Warthog (Phacochoerus aethiopicus): Warthog (Phacochoerus aethiopicus), information about warthog and warthog walk and stalk rifle and bow hunting in the Bushveld. ...
http://www.evolutionnyc.com/IBS/SimpleCat/Product/asp/product-id/83035.html

Warthog Skull - Phacochoerus aethiopicus (Replica): Home : Replica Skulls/ Skeletons : Animals : PAGE 6: : Warthog Skull Phacochoerus aethiopicus (Replica). Warthog Skull Phacochoerus aethiopicus (Replica). ...
http://www.evolutionnyc.com/IBS/SimpleCat/Shelf/ASP/Hierarchy/020O2Z.html

Evolution is a leading supplier of museum quality REPLICA SKULLS ...: Warthog Skull Phacochoerus aethiopicus (Replica). Item # / SKU: SS301. The warthog is found is most open country of Africa south of the Sahara. This area... ...
http://animalpicturesarchive.com/animal/EngNames/warthog.html

warthog (Phacochoerus aethiopicus): Animal Pictures Archive's Species Search Start Point. warthog (Phacochoerus aethiopicus) Family: Suidae, Click me to search. Home | New ...
http://www.lastrefuge.co.uk/images/html/warthog/image_html/warthog01.html

WARTHOG and HIPPOPOTAMUS - Element 1 of 15: WARTHOG (Phacochoerus aethiopicus), Etosha National Park, Namibia. ...
http://www.nature-wildlife.com/warttxt.htm

Warthog: WARTHOG, Phacochoerus aethiopicus. Images of Warthogs. WHAT IT IS. Naked swine of the savanna. Slimmer than other hogs, with level ...
http://dict.die.net/phacochoerus%20aethiopicus/

phacochoerus aethiopicus - definition by dict.die.net: Definition: phacochoerus aethiopicus. Search dictionary for. Source: Webster's Revised Unabridged Dictionary (1913) Wart hog \Wart ...
http://merops.sanger.ac.uk/speccards/inhibitor/SP003048.htm

Inhibitor of Phacochoerus aethiopicus (desert warthog): Phacochoerus aethiopicus (desert warthog). TAXONOMY. Taxonomy database identifier: 85517. Superkingdom, Eukaryota. Kingdom, Animalia. Subkingdom, Metazoa. ...
http://www.fotos-online.de/english/m/12/12546.htm

Foto:12546 - Wart Hog family (Phacochoerus aethiopicus), Samburu ...: © Klaus-Peter Wolf - 12546 Wart Hog family (Phacochoerus aethiopicus), Samburu National Reserve, Kenya. Home.
http://www.fotos-online.de/english/m/12/12550.htm

Foto:12550 - Wart Hogs (Phacochoerus aethiopicus), Samburu ...: ...- © Klaus-Peter Wolf - 12550 Wart Hogs (Phacochoerus aethiopicus), Samburu National Reserve, Kenya. Home.
http://www.meyers-naturfoto.de/afrika16.htm

Stefan Meyers Naturfotografie - Warzenschwein - Phacochoerus ...: ...- Afrika. Amerika. Europa. Kontakt. persönliches. Homepage. Warzenschwein Phacochoerus aethiopicus africanus Foto Nr. 181.
http://www.meyers-naturfoto.de/englisch/afrika16.htm

Stefan Meyers Nature Photography - Warthog - Phacochoerus ...: Africa. America. Europe. Contact. Biography. Homepage. Warthog Phacochoerus aethiopicus africanus Photo no. 181.
http://terroirs.denfrance.free.fr/p/recettes/curry_crocodile.html

Tdf - Recettes - Curry de crocodile: ...- ... du patrimoine culinaire, Cooking, région, régions, régionnalisme, humour, curry de crocodile, c. niloticus, phacochère, phacochoerus aethiopicus, curry. ...
http://www.bioresurs.uu.se/myller/skog/vartsvin2.htm

Skog - Utblick - Vårtsvin: Vårtsvin - Phacochoerus aethiopicus De stora vårtorna i ansiktet har gett vårtsvinet dess namn. Tillbakspil.
http://members.lycos.co.uk/moranlevy/honeymoon/warthog.html

Warthog: Warthog Phacochoerus aethiopicus. pics of Wildebeest
http://wildnetafrica.co.za/estate/capturecare/sectionb/b4_warthog/03_ebedes.html

WildNet Africa - Capture and Care Manual - Accommodation of the ...: Complete our guestbook form if you wish to be notified of the new edition. Accommodation of the warthog. Phacochoerus aethiopicus. H. Ebedes. The warthog... ...
http://wildnetafrica.co.za/estate/capturecare/sectionb/b4_warthog/02_espie.html

WildNet Africa - Capture and Care Manual -Transportation of the ...: Complete our guestbook form if you wish to be notified of the new edition. Transportation of the warthog. Phacochoerus aethiopicus. I. Espie. The warthog... ...
http://www.infochembio.ethz.ch/links/zool_saeuget_schweine.html

Schweine: Säugetiere: ...- ... Warthog (Phacochoerus aethiopicus) - Image. Warthog (Phacochoerus aethiopicus) - Text. Warthog (Phacochoerus aethiopicus) - Text and Images. ...
http://tiermagazin.naturecom.de/text/warzenschwein.html

Warzenschwein (Phacochoerus aethiopicus) - Bild und Info: ...- Infos über das Warzenschwein (Phacochoerus aethiopicus), einem Bewohner der afrikanischen Savannen. Mit Bild eines Warzenschweins. ...
http://www.fact-index.com/s/su/suidae.html

Suidae: In addition to numerous species of wild pig, the family includes the babirusa Babyrousa babyrussa and the warthog Phacochoerus aethiopicus. ...
http://www.fact-index.com/w/wa/warthog.html

Warthog: Warthogs (Phacochoerus aethiopicus) are wild members of the pig family that live in the plains and open woodlands of Africa. They ...
http://genome.ag.saga-u.ac.jp/research/ag97.html

Localization of swine PRE-1 homologues in 13 loci of Phacochoerus ...: Localization of swine PRE-1 homologues in 13 loci of Phacochoerus aethiopicus and Tayassu tajacu genomes, and their sequence divergence. ...
http://genome.ag.saga-u.ac.jp/research/ag96.html

A swine SINE (PRE-1 sequence) distribution in swine-related animal ...: The distribution of PRE-1 sequence (a swine SINE) among the animal species related to Sus scrofa, ie Phacochoerus aethiopicus and Tayassu tajacu, was examined ...
http://www.krugerpark.co.za/search/_Phacochoerus_Aethiopicus.html

Kruger National Park | Accommodation, Maps, Safari, Tours, Camps ...: Kruger National Park safari | Accommodation, Maps, Safari, Tours, Camps, Bookings. Information on ' Phacochoerus Aethiopicus'. 0 Record(s). ...
http://www.tierseiten.com/paarhufer/paarhufersystematik.html

Systematik der Paarhufer: ...- ... Waldschweine) Art: Hylochoerus meinertzhageni (Riesenwaldschwein) Gattung: Phacochoerus (Warzenschweine) Art: Phacochoerus aethiopicus (Warzenschwein) Unterart ...
http://encyclopedia.thefreedictionary.com/Warthog

Warthog - encyclopedia article about Warthog. Free access, no ...: In addition to numerous species of wild pig, the family includes the babirusa Babyrousa babyrussa and the warthog Phacochoerus aethiopicus. .... ...
http://encyclopedia.thefreedictionary.com/Rhyncophthirina

Rhyncophthirina - encyclopedia article about Rhyncophthirina. Free ...: Class: Mammalia Order: Artiodactyla Family: Suidae Genus: Phacochoerus species: aethiopicus Binomial name Phacochoerus aethiopicus Warthogs (Phacochoerus ...
http://www.floranimal.ru/pages/animal/b/210.html

БОРОДÐ?ВОЧÐ?ИК: РодÑ?твенные виды: КÐ?БÐ?Ð?; СВИÐ?ЬЯ ЯВÐ?Ð?СКÐ?Я. БОРОДÐ?ВОЧÐ?ИК (Phacochoerus aethiopicus). Млекопитающие ...
http://www.jagdschnitzerei.de/1054-warzenschwein-warzenkeiler-trophaeenschilder-afrika.html

Warzenschwein-Warzenkeiler-Phacochoerus aethiopicus ...: ...- Bestell- Nr: 1054. Trophäenschild 1054 gebeizt. Aufsatzfläche: 40 x 28 cm. Material: Lindenholz. Farbe: hell, dunkel. Colorierte Trophäenschilder ...
http://www.techimo.com/forum/showthread.php?t=21094

Do you like the new feature? - TechIMO Forums: Warthog. Phacochoerus Aethiopicus. Warthog's Avatar. Join Date: Oct 2001. Location: Fort Myer, VA. Posts: 5,064. Do you like the new feature? ...
http://www.techimo.com/photo/showphoto.php?photo=2371&password=&sort=1&cat=500&page=1

The commode at a glance Photo at TechIMO: Warthog Phacochoerus Aethiopicus Registered: Oct 2001 Location: Fort Myer, VA Posts: 5063, Sun Sep 29, 2002 12:33am, It IS entertaining ...
http://www.nhm.org/research/mammals/holdings/ARTIODAC.HTM

Mammal Collection Holdings - Order ARTIODACTYLA: ORDER ARTIODACTYLA FAMILY SUIDAE SUBFAMILY PHACOCHOERINAE Phacochoerus aethiopicus Kenya Nairobi District Prov 1 Phacochoerus aethiopicus Namibia 2 ...
http://www.animalinelmondo.com/animali/vedi.php?NewsId=553

FACOCERO ---> Animali nel Mondo: ...- FACOCERO. Caratteristiche generali. Il nome scientifico del facocero è Phacochoerus Aethiopicus che fa parte della famiglia dei Suidi. ...
http://www.funet.fi/pub/sci/bio/life/mammalia/artiodactyla/suidae/phacochoerus/

Phacochoerus: See [About maps]. Phacochoerus aethiopicus (Pallas, 1767) aethiopicus (Pallas, 1767); Spicil. Zool. 2: 2, TL: Cape of Good Hope 21.10.2001 (1). ...
http://www.webkenya.com/eng/safari/wildlife.php?id=3&let=&park=&type=&choice=1&rownb=100&print=0

Webkenya - Wildlife in Kenya - Warthog (Desert) in all Kenya parks: Wildlife in all Kenya parks. "Desert warthog" (Phacochoerus aethiopicus), NAMES. PICTURE GALLERY. [NB : Does not take into account subspecies ...
http://www.webkenya.com/eng/safari/wildlife.php?let=w&choice=1

Webkenya - Wildlife in Kenya - Warthog (Common) in all Kenya parks: AND IN AFRICA... African taxonomy & distribution, Back to top ¤. African taxonomy: Specifically distinct from the Desert warthog (Phacochoerus aethiopicus). ...
http://bnhm.berkeley.museum/browse/vertebrates_Mammalia_Artiodactyla_Suidae_Phacochoerus_all.php?ViewResults=vertebrates_Mammalia_Artiodactyla_Suidae_Phacochoerus_all

Berkeley Natural History Museums: Genus: Phacochoerus view specimens Phacochoerus (Unspecified) (5) view specimens Phacochoerus aethiopicus (Unspecified) (10) view specimens Phacochoerus ...
http://www.ru.ac.za/academic/departments/zooento/Martin/pulicidae.html

Checklist: South African Pulicid Fleas (Siphonaptera: Pulicidae): Rothschild Moeopsylla sjoestedti Rothschild 1908: 3. Mpumalanga and Northern Province, to Zimbabwe; hosted by Phacochoerus aethiopicus and Potamochoerus porcus ...
http://www.markuskappeler.ch/tex/texs/warzenschwein.html

Eritrea-Warzenschwein: ...- ... Bis vor wenigen Jahren waren sämtliche Warzenschwein-Populationen Afrikas zu einer einzigen Art, Phacochoerus aethiopicus, zusammengefasst worden. ...
http://www.btinternet.com/~pdj_photos/trips/kenm02.htm

Species: Warthog, Phacochoerus aethiopicus, 1, Mara Oloololo Escarpment, 14/02/2002. Warthog, Phacochoerus aethiopicus, 2, Mara Oloololo Escarpment, 14/02/2002. ...
http://www.painetworks.com/download/0401104_wilderness/

Click on individual thumbnails to view 432 pixel enlargements.: ...lovell. FileName: fp0350.JPG Keywords: warthog phacochoerus aethiopicus okavango delta botswana botswana1811 lovell. FileName: fp0351 ...
http://darwin.zoology.gla.ac.uk/~vsmith/gallery.html

Louse Image Gallery: Asian elephant). Haematomyzus hopkinsi Male (Family Haematomyzidae) ex: Phacochoerus aethiopicus (Desert Warthog). Haematomyzus hopkinsi ...
http://www.infol.it/cites/africa5.html

Cites - Africa: Phacochoerus aethiopicus (.... Facocero Wart-hog Appendici CITES: non presente COMMERCIO: non ha un alto valore comemerciale se non per farne trofei di caccia ...
http://www.sa-venues.com/wildlife/wildlife_warthog.htm

Neither graceful nor beautiful, warthogs are nonetheless ...: ADVERTISE. CONTACT. WILDLIFE GALLERY - WARTHOG - Phacochoerus aethiopicus. Information. ... Name: Phacochoerus aethiopicus. Size: Stands 30 inches at the shoulder. ...
http://www.torontozoo.com/meet_animals/enrichment/warthog_enrichment.htm

Warthog Enrichment: An experiment was conducted to test the reactions of a pair of warthogs (Phacochoerus aethiopicus) to the urinary samples of several species. ...
http://www.geocities.com/michaelsomers/page2.html

Recent Publications: Activity patterns and activity budgets of warthogs (Phacochoerus aethiopicus) in the Eastern Cape Province, South Africa. ... Warthog Phacochoerus aethiopicus. ...
http://www.geocities.com/michaelsomers/page3.html

Older Publications: Somers, MJ 1996. The Warthog (Phacochoerus aethiopicus). SA Game & Hunt 2(1): 6-7. ... Group structure and social behaviour of warthogs Phacochoerus aethiopicus. ...
http://zebrarug.com/skullmntgallery3_640.htm

Zebra Rugs,Skulls,Animal Bones, Skull Mounts & Animal Skin Rugs ...: Warthog Skull with Replica Tusks Phacochoerus Aethiopicus, Warthog Skull Mount (Medium Size) Phacochoerus Aethiopicus, Zebra Skull Mount Equus Burchelli, Spotted ...
http://www.iucn.org/themes/ssc/sgs/pphsg/APchap4-2.htm

Chapter 4.2- Action Plan: 7: Approximate former and present known distribution of the desert warthog (Phacochoerus aethiopicus ssp.) and the common warthog (P. africanus ssp.). ...
http://www.iucn.org/themes/ssc/sgs/pphsg/Status.htm

Conservation Status: Widespread and abundant / Known or believed relatively secure. Desert/Cape warthog. Phacochoerus aethiopicus delamerei. Known to be at risk or “vulnerable�. ...
http://www.infobiogen.fr/db/embl/EBfasta/mam.seq

em|U03038|AA03038 Antilocapra americana satellite DNA sequence. ...: GGGTGCAGCCCTAAAAAGCAAAAGAAAAAACAAAAACAAAAAACAGACAAACAAAAAGTC GGCACCTAACTTGGCAAACAGTAGACCTAA >em|AB000371|AB000371 Phacochoerus aethiopicus DNA, PRE-1 repeat ...
http://www.infobiogen.fr/db/embl/EBfasta_78/mam

emb|U03038|AA03038 Antilocapra americana satellite DNA sequence. ...: GGGTGCAGCCCTAAAAAGCAAAAGAAAAAACAAAAACAAAAAACAGACAAACAAAAAGTC GGCACCTAACTTGGCAAACAGTAGACCTAA >emb|AB000371|AB000371 Phacochoerus aethiopicus DNA, PRE-1 repeat ...
http://apt.allenpress.com/aptonline/?request=get-abstract&issn=1066-5234&volume=045&issue=01&page=0101

Sarcocystis dubeyella n. sp. and Sarcocystis phacochoeri n. sp. ...: Sarcocystis dubeyella n. sp. and Sarcocystis phacochoeri n. sp. (Protozoa: Sarcocystidae) from the Warthog (Phacochoerus aethiopicus) in South Africa. ...
http://politicalblockheads.com/politicalblockheads/glossary.htm

Political Blockheads Glossary: Warthog: wart·hog Singular: Phacochoerus aethiopicus Plural: A former professional indoor soccer team from Washington, DC, and in no way related to Capitol ...
http://concise.britannica.com/ebc/article?eu=407658

warthog -- Britannica Concise Encyclopedia Online Article: Warthog (Phacochoerus aethiopicus) Warthog (Phacochoerus aethiopicus) Karl H. Maslowski. Large-headed species (Phacochoerus aethiopicus ...
http://www.canr.uconn.edu/paine/afrecol/jamesres.html

James Restivo: May-June 2002. James Restivo. Warthog (Phacochoerus aethiopicus) infiltration and degradation in the South African bushveld habitat. ...
http://www.wildlifepics.co.za/archive/other.html

Wildlife Pictures - Image Archive -- Other: Panthera tigris, Asia; Jaguar: Panthera onca, South America; Warthog: Phacochoerus aethiopicus, Sub-Saharan Africa; Cape fur seal: Cape ...
http://www.inmagine.com/products_subcat_images.php?cdcode=01015

Wildlife Wonders : Royalty Free Stock Photos / Images ...: Yellowbilled Stork or Mycteria Ibis. Warthog or Phacochoerus Aethiopicus Africanus. 01015020 ... Similar Search. Warthog or Phacochoerus Aethiopicus Africanus. ...
http://www.nature-reserve.co.za/search/_Phacochoerus_Aethiopicus.html

Southern Africa Nature Reserves | South Africa Game Reserve ...: South Africa nature reserves | Krugerpark | Addo Elephant Park | Marekele | Kgalagadi | Wilderness. Information on ' Phacochoerus Aethiopicus'. 0 Record(s). ...
http://intron.bic.nus.edu.sg/chk/gbmam.out

Seq ID=LOCUS AALMTCYTOB 307 bp DNA MAM 24-MAR-2000 ORGANISM ...: ...- ... 0 ===== Seq ID=LOCUS AB000371 366 bp DNA MAM 15-FEB-2000 ORGANISM Phacochoerus aethiopicus Eukaryota; Metazoa ...
http://wikipedia.infostar.cz/s/su/suidae.html

Suidae: Spolu s Ä?etným druhem divokého prasete, rodina obsahuje babirusa Babyrousa babyrussa a warthog Phacochoerus aethiopicus. Úplný ...
http://genome.jouy.inra.fr/db/gcg/genbank/gb_om.seqcat

Aal532906 AJ532906 Alces alces kappa-casein gene, exon 4, isolate ...: 2/2000 390bp Ab000371 AB000371 Phacochoerus aethiopicus DNA, PRE-1 repeat sequence, clone:pa17. 2/2000 366bp Ab000372 AB000372 Phacochoerus ...
http://quin.unep-wcmc.org/isdb/taxonomy/tax-gs-search2.cfm?GenName=Phacochoerus&SpcName=aethiopicus

quin.unep-wcmc.org/isdb/taxonomy/tax-gs-search2.cfm?GenName=Phacochoerus&SpcName=aethiopicus: Similar pages ÃŽÃ’Ã?ßÄ Ã?ÀÃ?Ã?ÎÊÎÃ?ÛÒÃ?ÛÕ ORDO ARTIODACTYLA OWEN ... Genetica", 83(3):189-94. Sus salvanius Hodgson, 38, 60, Sm, M, routine, C,G, Bosma AA et al., 1983. "Genetica", 61: 99-106. Phacochoerus aethiopicus Pallas, 34 34. 58 ...
http://www.bionet.nsc.ru/chromosomes/artiodactyla/artioda2n.htm

Ibiñagabeitia Proiektua: ...horri: «Bitxia hamo, itsusiena esango dizut. Phacochoerus aethiopicus. Ene igoala». BBC-ko kazetariak ikus-entzulego zabaleko ...
http://www.savci.upol.cz/gal/_20/suidae.htm

[an error occurred while processing this directive] Phacochoerus aethiopicus [an error occurred while processing this directive] 41767
Desert Warthog, Phacochère Du Dèsert, Phacochère Oriental Desert Warthog, Phacochère Du Dèsert, Phacochère Oriental

Home | Search | About


Copyright SpeciesList.com 2003-2009