|
Phyllocladus trichomanoides -IUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.botanik.uni-bonn.de/conifers/po/ph/asplenifolius.htm Phyllocladus asplenifolius description: 1825, Phyllocladus rhomboidalis Rich. & A. Rich. 1826; Phyllocladus trichomanoides D. Don var. glaucus (Carr.) Parl. 1868, Phyllocladus serratifolius Nois. ... http://www.hyperdictionary.com/dictionary/phyllocladus+trichomanoides PHYLLOCLADUS TRICHOMANOIDES - Definition by HyperDictionary.com: PHYLLOCLADUS TRICHOMANOIDES. WordNet Dictionary. Definition: [n] medium tall celery pine of New Zealand. Synonyms: tanekaha. See Also: celery pine. ... http://www.hyperdictionary.com/dictionary/Phyllocladus+trichomanoides PHYLLOCLADUS TRICHOMANOIDES - Meaning and Definition of the Word: PHYLLOCLADUS TRICHOMANOIDES: Dictionary Entry and Meaning. WordNet Dictionary. Definition: [n] medium tall celery pine of New Zealand. Synonyms: tanekaha. ... http://mobot.mobot.org/cgi-bin/search_vast?onda=N31200164 Phyllocladus trichomanoides D. Don: Missouri Botanical Garden - w 3 TROPICOS Nomenclatural Data Base - 29 May 2004. Phyllocladus trichomanoides D. Don. Group - Gymnosperm ... http://mobot.mobot.org/cgi-bin/search_vast?onda=N31200156 Phyllocladus alpinus Hook. f.: Phyllocladus aspleniifolius var. alpinus (Hook. f.) H. Keng, 1978. ... http://bushman.chips.cwa.co.nz/phyllocladus_trichomanoides.htm Phyllocladus trichomanoides: Phyllocladus trichomanoides Tanekaha Celery Pine. A tree reaching 25m.leaf branchlets 2.5-7.5 cm. long, whorled. leaves also called ... http://bushman.chips.cwa.co.nz/scientific_names.htm Scientific names: Phormium cookianum Mountain Flax Wharariki. Phormium tenax Flax Harakeke. Phyllocladus trichomanoides Tanekaha. Pimelia prostrata. Pimelia tomentosa. ... http://define.ansme.com/words/p/phyllocladus_trichomanoides.html Phyllocladus trichomanoides - AnsMe.com Dictionary (define): Dictionary - Phyllocladus trichomanoides. ... Definition for Phyllocladus trichomanoides. Phyllocladus trichomanoides (noun) -. 1. medium ... http://phyllocladus_trichomanoides.bluerider.com/wordsearch/phyllocladus_trichomanoides phyllocladus trichomanoides - BlueRider.com: ...phyllocladus trichomanoides - listen | domain availability, Dictionary and Thesaurus entries for: phyllocladus trichomanoides. Your search results... ... http://www.pinetum.org/sp/PHtrichomanoides.htm Arboretum de Villardebelle: Phyllocladus trichomanoides Gallery. ... Phyllocladus trichomanoides, ¤ Phyllocladus trichomanoides - Seedling, shoot Arboretum de Villardebelle, France. ... http://www.sbs.auckland.ac.nz/info/schools/nzplants/gym_phyll_trichoman.htm Phyllocladus trichomanoides: Seed plants > Non-flowering plants > Native species > Photosynthetic stems > Phyllocladus trichomanoides. Tanekaha, celery pine: Phyllocladus trichomanoides. ... http://www.sbs.auckland.ac.nz/info/schools/nzplants/gym_struc_stem.htm Native conifer stem: More on Libocedrus. Phyllocladus trichomanoides (tanekaha) Branches arise in whorls in this family of conifers. (photo, Godfrey Boenke). Photosynthetic stems. ... http://www.members.bush.org.nz/planterguide/fact.cfm?species=Phyllocladus%20trichomanoides [NZERN] - Plant Fact - Phyllocladus trichomanoides: Phyllocladus trichomanoides. More Information: Species Fact Sheet. Species Name: Phyllocladus trichomanoides. Synonyms: Common Name/s: celery pine. ... http://www.members.bush.org.nz/plantgrow/fact.cfm?species=Phyllocladus%20trichomanoides [NZERN] - Growing Native Plants - Phyllocladus trichomanoides: Phyllocladus trichomanoides. tanekaha celery pine. ... http://www.bushmansfriend.co.nz/xurl/PageID/8692/function/viewprd/prd_id/94051/content.html 0459 - Phyllocladus trichomanoides tanekaha Celery Pine. Tree to ...: 0459 - Phyllocladus trichomanoides tanekaha Celery Pine. Tree to 20m. Attractive, ancient tree of forests. North cape to Taranaki ... http://www.bushmansfriend.co.nz/xurl/PageID/8692/function/prodlist/style/thumb/grpid/9298/content.html NZ Seeds Catalogue: 300 seeds per packet. View. 0459 - Phyllocladus trichomanoides tanekaha Celery Pine. Tree to 20m. Attractive, ancient tree of forests. ... http://www.nzseeds.co.nz/seed_list/Phyllocladus_trichomanoides.html Phyllocladus trichomanoides: Phyllocladus trichomanoides Celery pine Tanekaha Tall forest tree to 20m. ... 1 Packets of 50 seeds / Phyllocladus trichomanoides. ... http://www.nzseeds.co.nz/botanical.htm Botanical Name List: ...tomentosa. Pennantia corymbosa Phormium cookianum Phormium tenax Phormium tenax purpureum Phyllocladus trichomanoides Picea abies. ... http://www.boga.ruhr-uni-bochum.de/html/Phyllocladus_trichomanoides_Foto2.html Phyllocladus trichomanoides: ...- Familie: Phyllocladaceae (Blatteibengewächse) Art: Phyllocladus trichomanoides D. Don. Objekt: Ast mit jungen Zapfen, Phyllokladien. ... http://www.boga.ruhr-uni-bochum.de/gymnbgbowww.html BG Bochum, Gesamtliste Gymnospermen: ...- ... Microstrobos fitzgeraldii (F. Muell.) J. Garden & LAS Johnson, Podocarpaceae, New South Wales (Blue Mountains). * Phyllocladus trichomanoides D. Don var. ... http://www.esveld.nl/htmldia/p/phtric.htm Fa. C. Esveld Phyllocladus trichomanoides: Tel. 0172-213289 (0031 172 213289) Fax 0172-215714 (0031 172 215714) E-mail: info@esveld.nl. Phyllocladus trichomanoides. ... http://www.esveld.nl/htmldiaen/p/phtric.htm Fa. C. Esveld Picture and description of Phyllocladus ...: Tel. 0172-213289 (0031 172 213289) Fax 0172-215714 (0031 172 215714) E-mail: info@esveld.nl. Picture and description of Phyllocladus trichomanoides. ... http://scisun.nybg.org:8890/searchdb/owa/wwwcatalog.detail_list?this_id=3926644 NYBG Specimens Detailed Results: Name: Podocarpaceae Phyllocladus trichomanoides D. Don det. NC Goldstein, 1996. Image: Not Available. Location: United States of America. California. ... http://scisun.nybg.org:8890/searchdb/owa/wwwspecimen.search_list?taxon=Phyllocladus+trichomanoides+D.+Don+++++&projcode=NAGY NYBG Specimens Search Results: Current Name, Collector, Location, Type Status, ID. Phyllocladus trichomanoides D. Don, NC Goldstein 112 with Malcolm Ridenhour, United States of America. California. ... http://plantsdatabase.com/showimage/35887.html Plants Database: Picture of Celery Pine, New Zealand Celery Pine ...: Here is a picture of the plant Celery Pine, New Zealand Celery Pine (Phyllocladus trichomanoides), photographer kennedyh. Viewing pictures of... ... http://davesgarden.com/nl.php?date=2004-02-17 Dave's Garden Newsletter for February 17, 2004: ...echinata). kennedyh, Image Picture of Phyllocladus trichomanoides, Celery Pine, New Zealand Celery Pine (Phyllocladus trichomanoides). ... http://davesgarden.com/nl.php?date=2004-01-03 Dave's Garden Newsletter for January 3: ...palmbob, Image, Butcher's Broom (Ruscus hypoglossum). palmbob, Image, Celery Pine, New Zealand Celery Pine (Phyllocladus trichomanoides). ... http://plants.usda.gov/cgi_bin/plant_profile.cgi?symbol=PHYLL9 Plant Profile for Phyllocladus: Distribution of Phyllocladus trichomanoides. Cultivated, or not in the US. Phyllocladus trichomanoides celery pine, «Back to Top». ... http://home.clear.net.nz/pages/grantglazer/Kayak/MaterialsWood.htm Wood and Timber: The wood of choice for skin on frame ribs. Tanekaha Phyllocladus trichomanoides. Density kg/m3, Modulus of Rapture MPa, Modulus of Elasticity GPa. ... http://www.yourdictionary.net/dir/P3750.html Words beginning with P: Phyllocladaceae | phylloclade | Phyllocladus | Phyllocladus alpinus | Phyllocladus asplenifolius | Phyllocladus trichomanoides | phyllode | phyllodial ... http://www.conifers.co.nz/Additional_info/gallery_list.htm Index of Pictures: ...alpinus 'Cockaynes Blue'. Phyllocladus toa toa Close up. Phyllocladus trichomanoides Celery Pine. Picea abies 'Little Gem'. Picea abies 'Procumbens'. ... http://www.conifers.co.nz/PLANTINFORMATION/phyllocladus.html Phyllocladus: Cutting Grown, PB 2, 20 cm high x 12 cm wide, $14.00. *****. Phyllocladus trichomanoides - NZ native. Celery Pine. Moderately ... http://www.landcareresearch.co.nz/research/biodiversity/greentoolbox/gtbweb/result.asp Landcare - Green ToolBox native plant selector: Pennantia corymbosa Phebalium nudum Phormium cookianum Phormium tenax Phyllocladus alpinus Phyllocladus toatoa Phyllocladus trichomanoides Pittosporum colensoi ... http://www.landcareresearch.co.nz/research/biodiversity/invertebratesprog/faunaofnz/extracts/FNZ45/fnz45int.asp FNZ45 - Nemonychidae, Belidae, Brentidae (Insecta: Coleoptera ...: Phyllocladus toatoa: Rhicnobelus metallicus. Phyllocladus trichomanoides: Rhicnobelus metallicus. Rhinorhynchus phyllocladi Rhinorhynchus rufulus. Podocarpaceae. ... http://www.homolaicus.com/scienza/erbario/utility/botanica_sistematica/hypertext/1789.htm BOTANICA SISTEMATICA: ...- ... celery top pine; Phyllocladus glaucus; Phyllocladus hypophyllus; Phyllocladus rhomboidalis; Phyllocladus toatoa; Phyllocladus trichomanoides (Albero sempreverde ... http://www.homolaicus.com/scienza/erbario/utility/botanica_sistematica/hypertext/2241.htm BOTANICA SISTEMATICA: ...- ... trichomanoides, Termine utilizzato in: Phyllocladus trichomanoides (Albero sempreverde. Altezza: fino a m. 8. Fiori monoici.) tanekaha (Podocarpaceae). ... http://pacificislandtravel.com/new_zealand/about_destin/maori_language.asp Maori Language: ...takarangi, spiral design. tanekaha, Phyllocladus trichomanoides - celery pine. ... toatoa, Phyllocladus trichomanoides and P. glaucus - native trees. ... http://www.altongarden.com/gardeninfo/treesurvey.htm ALTON - Garden Information: Parrotia persica (Persian Witch Hazel). Phyllocladus ?glaucus. Phyllocladus trichomanoides (Tanekaha). Picea abies (Norway Spruce) NTRST. ... http://www.une.edu.au/botany/p.htm UNE: Botany: Herbarium Species List: P: ...- ... Panicum decompositum, Phyllocladus elatus, Potamogeton crispus. Panicum effusum, Phyllocladus trichomanoides, Potamogeton javanicus. Panicum ... http://www.cistus.com/plantlist/ph.html Cistus Nursery 2003-2004 Plant List: ...rectus ‘Sunshine’ Phygelius ¥ rectus ‘Winchester Fanfare’ Phyllocladus asplenifolius [UCSC form] Phyllocladus [trichomanoides var.] alpinus ... http://www.nationmaster.com/encyclopedia/Trees-of-New-Zealand Encyclopedia: Trees of New Zealand: Phyllocladus alpinus; Rimu Dacrydium cupressinum; Tanekaha Phyllocladus trichomanoides; Totara Podocarpus totara; Toatoa Phyllocladus ... http://www.gardeningdatabase.co.uk/PlantP.aspx Number of plants in this list:- 1047: ...nodifera Phyllitis scolopendrium Phyllitis scolopendrium Phyllocladus alpinus Phyllocladus aspleniifolius Phyllocladus trichomanoides Phyllospadix scouleri ... http://www.ibiblio.org/pfaf/database/latinP.html Plants For A Future Datebase: Index of Latin Names: P: Phragmites australis Phryma leptostachya Phyla nodifera Phyllocladus alpinus Phyllocladus aspleniifolius Phyllocladus trichomanoides, Phyllospadix scouleri ... http://www.irelandseye.com/aarticles/travel/attractions/gardens/fota_arb.shtm Fota Island Arboretum, County Cork: Shoonng upwards, a Phyllocladus trichomanoides from New Zealand, planted in 1941, is now twenty-two-feet high, the tallest in the British Isles. ... http://www.thefreedictionary.com/celery%20pine celery pine definition of celery pine. What is celery pine? ...: Phyllocladus trichomanoides, tanekaha - medium tall celery pine of New Zealand. Alpine celery pine, Phyllocladus alpinus - small shrubby celery pine of New ... http://www.thefreedictionary.com/Phyllocladus%20asplenifolius Phyllocladus asplenifolius definition of Phyllocladus ...: Home Word: Word. Phyllocladus asplenifolius. Noun, 1. Phyllocladus asplenifolius - medium tall celery ... http://131.220.103.1/conifers/topics/big_index.htm Gymnosperm Database complete taxonomic index: ...- ... Phyllocladus alpinus. Phyllocladus asplenifolius, Phyllocladus hypophyllus, Phyllocladus toatoa, Phyllocladus trichomanoides. Picea abies, ... http://www.hackfalls.com/cat/?cat=P Hackfalls Arboretum: Phygelius x rectus cv. Phyllocladus alpinus ‘Cockayne's Blue’. Phyllocladus trichomanoides. Phyllostachys aurea. Phyllostachys nigra var. henonis. ... http://www.free-definition.com/Trees-of-New-Zealand.html Trees of New Zealand Definition Meaning Information Explanation: Dacrydium cupressinum; Totara Podocarpus totara. Phyllocladaceae (toatoa family): Tanekaha Phyllocladus trichomanoides; Toatoa Phyllocladus ... http://www.stabg.freeserve.co.uk/corridor.htm Glasshouse Corridor: Representative plants from Australasia include the unusual conifer Phyllocladus trichomanoides from New Zealand and Acacia dealbata and species of Callistemon ... http://www.rhs.org.uk/research/registration_conifers_accepted.asp Royal Horticultural Society - Research: ...f. (1852) Phyllocladus toatoa Molloy (1996) Phyllocladus trichomanoides D. Don (1832) Phyllocladus trichomanoides var. alpinus (Hook. f.) Parl. ... http://python.ex.ac.uk/ead/be/species/LIST.OF.SPECIESP.htm List of plant species - P: ...capensis 7240 Phyllitis scolopendrium 7184 Phyllitis scolopendrium Crispa 3420 Phyllocladus asplenifolius 4662 Phyllocladus trichomanoides 5652 Phyllodoce ... http://www.bioquest.org/bioinformatics/workshops/bsa_02/data/chaw_data.txt gi|7670295|dbj|AB029362.1| Phyllocladus trichomanoides ...: ...>gi|7670295|dbj|AB029362.1| Phyllocladus trichomanoides mitochondrial gene for 18S rRNA AGCTATATGCTTAACACATGCGAGTCGAACGTTGCTTCCGTGCTTCCCGGGCAGAAGCGCTTTAGCACTG ... http://www.angelfire.com/bc/eucalyptus/iansplants/gallery/46/ IAN'S PLANTS - photo gallery: These plants from New Zealand also reach perfection in this climate. Phyllocladus trichomanoides, a rare and interesting conifer from New Zealand. ... http://www.fore.canterbury.ac.nz/fore214/species.htm FORE214 - Species list: NZ) 6> Genus Lepidothamnus a: Lepidothamnus intermedius (Lirk) Quinn - yellow-silver pine (NZ) 7> Genus Phyllocladus a: Phyllocladus trichomanoides D.Don ... http://www.fore.canterbury.ac.nz/species/species.htm FORE214 - Species list: ...miro (NZ) b: Prumnopitys taxifolia (D.Don) Laubenf. - matai (NZ) 6> Genus Phyllocladus a: Phyllocladus trichomanoides D.Don - tanekaha, celery (NZ) e> Family ... http://www.selfheal.co.nz/aubert.html Self Heal - Aubert: Sore throats and toothache. Analgesic. TANEKAHA Phyllocladus trichomanoides - The most important New Zealand herb for the liver. Useful for skin disorders. ... http://www.selfheal.co.nz/relax.html Self Heal- Relaxant: TANEKAHA (Celery pine) Phyllocladus trichomanoides - Liver tonic, helping the general constitution. Used for dysentery or diarrhoea. ... http://www.woodbook.co.uk/T%20-%20Z.htm T - Z: It is evergreen. Tanekaha, Phyllocladus trichomanoides, Distribution : New Zealand. Very flexible. Clear light coloured wood without much grain detail. ... http://www.worldwildlife.org/wildworld/profiles/terrestrial/aa/aa0406_full.html Terrestrial Ecoregions -- Northland temperate kauri forests ...: The common broadleaf tree species in mixed kauri forest include: tanekaha (Phyllocladus trichomanoides), towai (Weinmannia silvicola), kanuka (Kunzea ericoides ... http://www.speciesaccounts.org/Pinopsida.htm Pinopsida: ...- ... Widdringtonia 2. Widdringtonia 3. Phyllocladus (Phyllocladaceae) (4 spp). Phyllocladus trichomanoides. Phyllocladus 2. Phyllocladus 3. Phyllocladus 4. ... http://www.kiwiherb.com/winter.cfm?ProductGroupId=3 Kiwiherb - Herbal products from New Zealand - Products: ...gums. A high potency herbal mouthwash made from Manuka (Leptospermum scoparium) and Tanekaha (Phyllocladus trichomanoides). Tests ... http://www.bad-breath-fix.com/bad-breath-resources/18/children's-mouthwash.html children's mouthwash: NZ native products ... A high potency herbal mouthwash made from Manuka (Leptospermum scoparium) and Tanekaha (Phyllocladus trichomanoides ... ... http://natures-bounty.org/relax.html Natures Bounty Natural Herbal Remedies, Rexaxant: TANEKAHA (Celery pine) -- Phyllocladus trichomanoides Liver tonic, helping the general constitution. Used for dysentery or diarrhoea. ... http://www.kiwiherb.co.nz/winter.cfm?ProductGroupId=3 Kiwiherb Products - Herbal products from New Zealand: ...gums. A high potency herbal mouthwash made from Manuka (Leptospermum scoparium) and Tanekaha (Phyllocladus trichomanoides). Flavoured ... http://relations.ansme.com/words/p/phyllocladus_trichomanoides.html Phyllocladus trichomanoides - AnsMe.com Dictionary (relations): ...phylloquinone Phyllorhynchus Phylloscopus. Dictionary - Phyllocladus trichomanoides. Show Definition. ... Rhymes. Translate. Relations for Phyllocladus trichomanoides. ... http://www.esapubs.org/archive/appl/A010/001/appendix-A.htm Ecological Archives A010-001: ...cliffortioides Nothofagus truncata Olearia arborescens Olearia avicenniaefolia Phyllocladus alpinus Phyllocladus trichomanoides Pittosporum eugenioides ... http://rhymes.ansme.com/words/p/phyllocladus_trichomanoides.html Phyllocladus trichomanoides - AnsMe.com Dictionary (rhymes): ...phylloquinone Phyllorhynchus Phylloscopus. Dictionary - Phyllocladus trichomanoides. Show Definition. ... Rhymes for Phyllocladus trichomanoides. No Rhymes Found. ... http://www.beetfoundation.com/words/t/tanekaha.html tanekaha: ...tanekaha. 1 definition found From WordNet r 1.6 [wn]: tanekaha n : medium-tall celery pine of New Zealand [syn: {Phyllocladus trichomanoides}]. ... http://www.greatbarrier.co.nz/articles/botsoc2.htm Day 2: H. gibbosa & H. sericea) but that hid many treasures such as kauri, Brachyglottis kirkii, tanekaha (Phyllocladus trichomanoides), pohutukawa (Metrosideros ... http://www.rsnz.org/publish/nzjar/1997/23.php Gerard et al.--Gymnosperm activity against L. cuprina: Halocarpus bidwillii; H. biformis; H. kirkii; Lagarostrobos colensoi; Lepidothamnus intermedius; L. laxifolius; Phyllocladus trichomanoides; P. glaucus, and ... http://www.websters-dictionary-online.org/definitions/english/Ce%5Ccelery.html Celery: Webster's Online Dictionary The Rosetta Edition™. ... http://www.realdictionary.com/P/Ph.asp English Dictionary - Displaying all words starting with Ph: Phycomycetes phycomycosis phyle Phyllidae Phyllitis Phyllium phylloclad phylloclade Phyllocladus alpinus Phyllocladus trichomanoides phyllodial Phyllodoce ... http://home.t-online.de/home/haasep/publicat.htm List of publications: 63. Haase, P. 1992. Isozyme variation and genetic relationships in Phyllocladus trichomanoides and P. alpinus (Podocarpaceae). New ... http://www.radiocarbon.org/Journal/v37n2/Abstracts/155.html Abstract 37(2), p. 155: ...and terminating at the last Taupo (New Zealand) eruption, derived from a sequence of 10-yr samples of tree rings from Phyllocladus trichomanoides (celery pine ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=7515625&dopt=Abstract Inhibition of eukaryote signal-regulated protein kinases by plant ...: The cladodes of Phyllocladus trichomanoides, the bark of Pseudotsuga menziesii and the heartwood of Acacia melanoxylon contain catechin derivatives that are ... http://www.worldwideshoppingmall.co.uk/body-soul/shelves/kiwi-herbs-nznf.asp Kiwi Herbs, New Zealand Natural Foods, Body and Soul Health Shop ...: A high potency herbal mouthwash made from the traditional New Zealand herbs Manuka (Leptospermum scoparium) and Tanekaha (Phyllocladus trichomanoides). ... http://www.b-and-t-world-seeds.com/comtauz.htm Common Names: Ta Ch'Ing to Uzun Logusaotu: Tanacetum vulgare Tanajica Nepeta teydea Tanaribe Pourouma cecropiifolia Tanbark Oak Lithocarpus densiflorus Tanekaha Phyllocladus trichomanoides Tang Kuei ... http://soundslike.ansme.com/words/p/phyllocladus_trichomanoides.html Phyllocladus trichomanoides - AnsMe.com Dictionary (sounds like): Dictionary - Phyllocladus trichomanoides. Show Definition. Sounds Similar. ... Sounds Similar for Phyllocladus trichomanoides. [Method 1] [Method 2] [Method 3] ... http://cow.epicdb.com:81/w-phone-epicdbcom81-cow.html EPICdb.com - avermedia dvd ezmaker pciadapter graphic pci standard: The is directory phone exist forgotten. Ought left phyllocladus trichomanoides phone book pending. Across swear this lookup phone reverse unbent. ... http://www.ew.govt.nz/enviroinfo/land/biodiversity/fragments/restoring/planting/plantingguide.htm EW - What to Plant in Waikato Forest Fragments: ...uplands. Flax Phormium tenax, 1, 1, 1, 1-2, Y, mod, flax, throughout. Tanekaha Phyllocladus trichomanoides, 1, 2, 3, 3, mod, tree, throughout. Lemonwood ... http://www.newcrops.uq.edu.au/listing/dysoxylumspectabile.htm dysoxylumspectabile: Changes in structure and composition over fifteen years in a secondary kauri (Agathis australis) and tanekaha (Phyllocladus trichomanoides) forest stand ... http://www.independentcommerce.com/icDirectory/keyword.asp?keyword=tanekaha Amazon.com: All Products Search Results: tanekaha: ...tention.TANBARK-OAK is Lithocarpus densiflorus.TANEKAHA is Phyllocladus trichomanoides.TANGELO is ..." See more reference to tanekaha in this book. ... http://www.biologie.uni-hamburg.de/b-online/earle/topics/synindex.htm Synonym index: Phyllocladus Phyllocladus aspleniifolius var. alpinus Phyllocladus major Phyllocladus protractus Phyllocladus rhomboidalis Phyllocladus trichomanoides var. ... http://eol.sdsc.edu/perl/tax_beta.pl?type=down&val=58024 PAT NCBI Taxonomy Browser: ...*****3362, Phyllocladus, genus. *****50183, Phyllocladus trichomanoides, species. *****50183, Phyllocladus hypophyllus, species. ... http://www.fernfarm.co.nz/Trees.htm Native Tree Species List: Lovely leaves. Phyllocladus trichomanoides, Tanekaha, Celery Pine Fairly fast growing, Tolerates some wind. Sophora sp, Kowhai Fast growing. ... http://www.goodnessdirect.co.uk/cgi-local/detail/878537.html GoodnessDirect - Kiwiherb Manuka Mouthwash 100ml: Aqua, certified organic &/or wildcrafted extracts of dried: manuka (Leptospermum scoparium), tanekaha (Phyllocladus trichomanoides), liquorice (Glycyrrhiza ... http://www.cleanbeauty.org/planteboeger.htm Bøger: Pris 348 kr. Her bringes et uddrag af bogen med beskrivelse af det New Zealandske træ Tanekaha. Tanekaha - Phyllocladus trichomanoides. Nr. A 9. ... http://www.maf.govt.nz/forestry/publications/development-of-maori-owned-indigenous-forests/maori-forests11.htm [an error occurred while processing this directive] Phyllocladus trichomanoides [an error occurred while processing this directive] 42269 Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |