|
|
Reithrodontomys fulvescens - Fulvous Harvest MouseIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.nsrl.ttu.edu/projects/surveytx.htm Biological Survey: Plecotus townsendii Tadarida brasiliensis Geomys bursarius Perognathus flavus Chaetodipus hispidus Reithrodontomys fulvescens Reithrodontomys megalotis ... http://www.ukans.edu/~mammals/reithro-fulves.html New World Mice And Rats (Family Cricetidae): Fulvous Harvest Mouse Reithrodontomys fulvescens aurantius JA Allen Description: The fulvous harvest mouse is the largest and most ... http://www.ukans.edu/~mammals/list.html Mammals of Kansas: Peromyscus attwateri White-footed Mouse Peromyscus leucopus Deer Mouse Peromyscus maniculatus Fulvous Harvest Mouse Reithrodontomys fulvescens Western Harvest ... http://www.snomnh.ou.edu/mammalkey/Reithrodontomys_fulvescens.html Oklahoma Museum of Natural History: Reithrodontomys fulvescens (Fulvous Harvest Mouse). Counties ... species. Search the OMNH Collections for Reithrodontomys fulvescens. http://www.snomnh.ou.edu/mammalkey/scientific_names.html Oklahoma Museum of Natural History: R Rattus norvegicus Rattus rattus Reithrodontomys fulvescens Reithrodontomys humulis Reithrodontomys megalotis Reithrodontomys montanus ... http://www.cnas.smsu.edu/bullshoals/WildlifeDiversity/FullRecord.asp?ID=38 Wildlife Diversity - Search Results: We are currently writing more descriptive information for this animal. Species Name: Reithrodontomys fulvescens. Common name: Harvest Mouse. Subphylum: ... http://www.cnas.smsu.edu/bullshoals/WildlifeDiversity/Mammals/Common.asp Wildlife Diversity - Mammals: Gray Bat, Myotis grisescens. Harvest Mouse, Reithrodontomys fulvescens. Little Brown Bat, Myotis lucifugus. Northern Long eared bat, Myotis septentrionalis. ... http://www.fw.vt.edu/fishex/nmex_main/species/050390.htm BISON Species Account 050390: 050390 Fulvous Harvest Mouse Reithrodontomys fulvescens. Biota Information System Of New Mexico BISON. version 1/2000. ... Scientific Name, Reithrodontomys fulvescens. ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0022-2372&volume=085&issue=02&page=0196 CHARACTERISTICS OF DIET OF <GENSP>PEROMYSCUS AZTECUS</GENSP> AND ...: Journal of Mammalogy: Vol. 85, No. 2, pp. 196–205. CHARACTERISTICS OF DIET OF PEROMYSCUS AZTECUS AND REITHRODONTOMYS FULVESCENS IN MONTANE WESTERN MEXICO. ... http://apt.allenpress.com/aptonline/?request=get-abstract&issn=0022-2372&volume=081&issue=01&page=0077 POPULATION AND COMMUNITY ECOLOGY OF SMALL RODENTS IN MONTANE ...: Heteromyidae) of small rodents were captured (Hodomys alleni, Liomys pictus, Oryzomys couesi, Peromyscus aztecus, Reithrodontomys fulvescens, R. sumichrasti ... http://www.bioone.org/bioone/?request=get-abstract&issn=0022-2372&volume=085&issue=02&page=0196 CHARACTERISTICS OF DIET OF <GENSP>PEROMYSCUS AZTECUS</GENSP> AND ...: Journal of Mammalogy: Vol. 85, No. 2, pp. 196–205. CHARACTERISTICS OF DIET OF PEROMYSCUS AZTECUS AND REITHRODONTOMYS FULVESCENS IN MONTANE WESTERN MEXICO. ... http://www.bioone.org/bioone/?request=get-document&issn=0003-0031&volume=139&issue=02&page=0262 Communities of Small Mammals in Six Grass-dominated Habitats of ...: 53% of all captures), deer mouse (Peromyscus maniculatus; 21%), house mouse (Mus musculus; 10%), fulvous harvest mouse (Reithrodontomys fulvescens; 7%), and ... http://www.ksu.edu/kansasgap/KS-GAPPhase1/finalreport/mammal_model_list.htm KS-GAP Mammals: AMAFF02030, Western Harvest Mouse, Reithrodontomys megalotis, Resident. AMAFF02050, Fulvous Harvest Mouse, Reithrodontomys fulvescens, Resident. ... http://www.concyteq.org.mx/cqrn2/mamifer.htm mamiferos: ...- ... Reithrodontomys sumichrasti sumichrasti, Reithrodontomys fulvescens toltecus, Reithrodontomys fulvescens tropicalis, Peromyscus maniculatus labecula, ... http://www.cdc.gov/ncidod/eid/vol5no1/kuenzi.htm A Longitudinal Study of Sin Nombre Virus Prevalence in Rodents ...: Other species captured infrequently (<1%) included the fulvous harvest mouse (Reithrodontomys fulvescens), yellow-nosed cotton rat (Sigmodon ochrognathus ... http://www.ibiologia.unam.mx/ebchamela/www/mamiferos.htm Orden: ...- ... Reithrodontomys fulvescens nelsoni, 63, Ratón, American harvest mice, Insectívoro. . Sigmodon mascotensis mascotensis, 64, Rata, Cotton rat, Herbívoro. . ... http://tariacuri.crefal.edu.mx/sigapatz/estudios/estribo_grande/estrib10c.html Pagina nueva 1: ...- ... EM. 22. Reithrodontomys sumichrasti. Ratón de campo. 23. Reithrodontomys fulvescens. Ratón de campo. 24. Reithrodontomys microdon. Ratón de campo. A *. 25. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.muridae.reithrodontomys.html Thumbnails Page, Rodentia Muridae Reithrodontomys: Rodentia Muridae Reithrodontomys (Click on thumbnail to view larger image). American harvest mouse (Reithrodontomys fulvescens), photo by Ernest P. Walker. ... http://www.enature.com/search/show_search_byHabitat.asp?curGroupID=5&habitat=1044&curPageNum=4 eNature.com - Nature and Wildlife Field Guides: Rats. select Deer Mouse Peromyscus maniculatus Mice and Rats. select Fulvous Harvest Mouse Reithrodontomys fulvescens Mice and Rats. ... http://www.enature.com/fieldguide/showSpeciesSH.asp?curGroupID=5&shapeID=1039&curPageNum=45&recnum=MA0398 Fulvous Harvest Mouse, eNature.com: Fulvous Harvest Mouse(Reithrodontomys fulvescens), Mice and Rats eNature.com is a free searchable nature and wildlife database. site ... http://www.bbspvo.org/animals/mammal.htm Mammal Checklist: Marsh Rice Rat, Oryzomys palustris. Fulvous Harvest Mouse, Reithrodontomys fulvescens. Eastern Harvest Mouse, Reithrodontomys humulis. ... http://www.rra.dst.tx.us/bi/mammal/ri/moore.cfm Mammals of Moore County, Texas: Fulvous Harvest Mouse (Reithrodontomys fulvescens) Western Harvest Mouse (Reithrodontomys megalotis) Plains Harvest Mouse (Reithrodontomys montanus) Texas ... http://www.rra.dst.tx.us/bi/mammal/ri/armstrong.cfm Mammals of Armstrong County, Texas: Banner-tailed Kangaroo Rat (Dipodomys spectabilis). Fulvous Harvest Mouse (Reithrodontomys fulvescens). Western Harvest Mouse (Reithrodontomys megalotis). ... http://maraisdescygnes.fws.gov/mdc3.htm Area Wildlife Species Lists for Marais des Cygnes National ...: American Beaver. Castor canadensis. Fulvous Harvest Mouse. Reithrodontomys fulvescens. Western Harvest Mouse. Reithrodontomys megalotis. Plains Harvest Mouse. ... http://www.prysm.net/~lsusmus/mammals.html Checklist of Mammals: ...palustris -- Marsh Rice Rat Peromyscus gossypinus -- Cotton Mouse Peromyscus leucopus -- White-footed Mouse Reithrodontomys fulvescens -- Fulvous Harvest Mouse ... http://www.prysm.net/~lsusmus/bios.html The Biodiversity of the Ouachita Mountains Biological Station: 39. Tamias striatus -- LSUS 124. Peromyscus leucopus -- LSUS 64. Reithrodontomys fulvescens -- LSUS 55. Neotoma floridana -- LSUS 422. http://www.interaktv.com/MS/MSMammals.html Biologybase: Mississippi Mammals: Beaver, Castor canadensis. Eastern Harvest Mouse, Reithrodontomys humulis. Fulvous Harvest Mouse, Reithrodontomys fulvescens. White-footed Mouse, Peromyscus leucopus. ... http://www.oreilly.com/catalog/pythonsl/colophon.html oreilly.com -- Online Catalog: Python Standard Library: The Western, Eastern, and Fulvous harvest mice (Reithrodontomys megalotis, Reithrodontomys humulis, and Reithrodontomys fulvescens, respectively) currently ... http://www.pnas.org/cgi/content/full/97/13/7074 PNAS -- Sánchez-Cordero and Martínez-Meyer 97 (13): 7074: ...melanotis O, Peromyscus aztecus G, Peromyscus leucopus G, Peromyscus levipes G, Peromyscus maniculatus G, Reithrodontomys fulvescens G, Reithrodontomys ... http://www.texasreptiles.com/trba/species.html Texas Reptiles: Fulvous Harvest Mouse - (Reithrodontomys fulvescens) Eastern Harvest Mouse - (Reithrodontomys humulis) Western Harvest Mouse - (Reithrodontomys megalotis ... http://www.discoverlife.org/nh/id/tmp/20q/html/Mammalia/Muridae.html Kinds of Mammalia: Rattus norvegicus, Norway Rat. Rattus rattus, Black Rat. Reithrodontomys fulvescens, Fulvous Harvest Mouse. Reithrodontomys humulis, Eastern Harvest Mouse. ... http://nasa.utep.edu/chih/chklist/mammals/keys/keymurid.htm Key to Muridae: Occlusal pattern of last lower molar S-shaped; occipitonasal length usually more than 22 mm; dorsal color usually rich golden brown: Reithrodontomys fulvescens ... http://nasa.utep.edu/chih/chklist/mammals/keys/mammtab.htm Classification Table: Peromyscus truei: Pinyon Mouse, ditto. Reithrodontomys fulvescens: Fulvous Harvest Mouse, ditto. Reithrodontomys megalotis: Western Harvest Mouse, ditto. ... http://ag.arizona.edu/SRER/history/appendix.html The Santa Rita Experimental Range: Peromyscus merriami Mearns, Merriam mouse. Reithrodontomys fulvescens, Fulvous harvest mouse. Reithrodontomys megalotis (Baird), Desert harvest mouse. ... http://www.dfg.ca.gov/whdab/html/M123.html M123: 72:67-69. Cameron, GN 1977. Experimental species removal: demographic responses by Sigmodon hispidus and Reithrodontomys fulvescens. J. Mammal. 58:488-506. ... http://www.cast.uark.edu/cast/geostor/data_available/metadata/PredictedFulvousHarvestMouseHabitat.htm SMMS METADATA REPORT: This portion of the GAP project produced predicted distribution maps for the Fulvous Harvest Mouse (Reithrodontomys fulvescens). ... http://www.mammalsociety.org/statelists/newmexico.html ASM | Mammals of New Mexico: Castoridae, Beaver, Castor canadensis, OT, 247(H), 248(H), 408, 409(H), 410(H), 1239, 120, Muridae, Fulvous Harvest Mouse, Reithrodontomys fulvescens, GL, 174, ... http://www.mammalsociety.org/statelists/ksmammals.html ASM | Mammals of Kansas: Norway rat. Fulvous harvest mouse, Reithrodontomys fulvescens, uncommon, southeast corner, 174, almost exclusively nocturnal. Western harvest ... http://www.nps.gov/coro/mammal.htm Coronado National Memorial Mammals: Peromyscus boylii; Western harvest mouse Reithrodontomys megalotis; Fulvous harvest mouse Reithrodontomys fulvescens; Arizona cotton ... http://www.nps.gov/amis/mammalist.htm Mammals of Amistad National Recreation Area: Davis &Schmidly 1994). Reithrodontomys fulvescens, Fulvous harvest mouse___, Historically found in area. Peromyscus eremicus, Cactus ... http://www.apria.com/resources/1,2725,494--May%208%202004,00.html Apria - resources - News: 2004 Catholic hospitals and Rome not on universal footing May 08 2004 Characteristics of Diet of Peromyscus Aztecus And Reithrodontomys Fulvescens in Montane ... http://www.visitbigbend.com/about_mammals.html Visit Big Bend - mammals: ...___ Fulvous Harvest Mouse (Reithrodontomys fulvescens) -- EXTREMELY RARE Occurs only in grassland areas of Pine Canyon, Juniper Canyon, and Green Gulch. ... http://www.bullshoals.smsu.edu/databases/animals/record.asp?ID=38 BSFS Databases: Animals at BSFS. Species Name: Reithrodontomys fulvescens; Common name: Harvest Mouse; Subphylum: Class: Mammalia; Collection date: Fall ... http://sparc.ecology.uga.edu/webdocs/species/scripts/Mammals.csv Order,Family,Genus and Species,Authority,Year,Common Name Edentata ...: ...polionotus,Osgood,1904,Oldfield mouse Rodentia,Muridae,Podomys floridanus,Chapman,1889,Florida mouse Rodentia,Muridae,Reithrodontomys fulvescens,Allen,1894 ... http://www.swf-wc.usace.army.mil/waco/mamls.htm Waco Lake, Texas - Mammals: American Beaver Castor canadensis (Kuhl). Fulvous Harvest Mouse Reithrodontomys fulvescens (Allen). Plains Harvest Mouse Reithrodontomys montanus (Baird). ... http://www.mlws.org/MAMMALS.htm Mammalian Species List for Mitchell Lake: Dipodomys compactus, Gulf Coast Kangaroo Rat, Muridae, Reithrodontomys fulvescens, Fulvous Harvest Mouse, YES. Reithrodontomys montanus, Plains Harvest Mouse, YES. ... http://www.esajournals.org/esaonline/?request=get-abstract&issn=0012-9658&volume=064&issue=06&page=1471 Patterns of Habitat Utilization in Sympatric Rodents on the Texas ...: Habitat utilization by Sigmodon hispidus, Reithrodontomys fulvescens, and Oryzomys palustris was compared to habitat availability, by determining if capture ... http://www.esajournals.org/esaonline/?request=get-abstract&issn=0012-9658&volume=053&issue=04&page=0653 Experimental Manipulation of Population Density in Three Sympatric ...: Three abundant rodents, the cotton rat (Sigmodon hispidus), the harvest mouse (Reithrodontomys fulvescens), and the rice rat (Oryzomys palustris) are sympatric ... http://www.fieldherpers.com/breeding/messages/31.html Has anyone ever tried breeding some of the other small NA species?: ...approximately 2 grams at birth. Reithrodontomys fulvescens only weigh 3 - 3.5 grams when they wean at 16 days of age. There is no birth ... http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180340 ITIS Standard Report Page: Reithrodontomys: ...mice, Direct Children: Species, Reithrodontomys fulvescens JA Allen, 1894 -- fulvous harvest mouse, Ratón-cosechero leonado, Species, ... http://www.geocities.com/HotSprings/Oasis/6455/animals-links.html Animals - Pets and Wildlife - and Lyme Disease: 5 on 20 Feb 00 MEDLINE - pinyon mouse (Peromyscus truei) AND Lyme disease - 3 on 20 Feb 00 MEDLINE - harvest mouse (Reithrodontomys fulvescens) AND Lyme ... http://www.booksmatter.com/b0826213596.htm The Wild Mammals of Missouri: 195, (1). Western Harvest Mouse (Reithrodontomys megalotis). 196, (4). Fulvous Harvest Mouse (Reithrodontomys fulvescens). 200, (2). Peromyscus Mice. 202, (1). ... http://www.msstate.edu/org/MAS/apriljournal/land.html Land Mammals of Mississippi: ...statewide; common. Reithrodontomys fulvescens (fulvous harvest mouse)--Southwestern two-thirds of state; fairly common. Reithrodontomys ... http://sagemap.wr.usgs.gov/ftp/kansas/GAP/kshex_mamm.htm KS-GAP Hexagon Distribution - Mammals: Harvest Mouse Theme_Keyword: Reithrodontomys megalotis Theme_Keyword: Fulvous Harvest Mouse Theme_Keyword: Reithrodontomys fulvescens Theme_Keyword: Deer Mouse ... http://cfpub.epa.gov/ncer_abstracts/index.cfm/fuseaction/display.abstractDetail/abstract/894/report/1999 EPA: ORD: NCER: Advanced Search: Other species in the assemblage include Reithrodontomys fulvescens, Chaetodipus hispidus, Neotoma floridana, Peromyscus leucopus, P. maniculatus, Mus musculus ... https://coopunits.org/People/david.leslie/Events?TemplateType=PaperPresented Cooperative Research Units Program: Events: 19 June 2000. Comparative nitrogen requirements of Sigmodon hispidus and Reithrodontomys fulvescens: does dietary niche matter? ... https://coopunits.org/People/david.leslie/Events/index_html?submit=+View+List+&TemplateType=PaperPresented&sort_on=Citation Cooperative Research Units Program: Events: 17 June 2001. Comparative nitrogen requirements of Sigmodon hispidus and Reithrodontomys fulvescens: does dietary niche matter? ... http://www.lastgreatplaces.org/SanPedro/biodiversity_mammals.html Last Great Places - San Pedro - Mammals: Plains Harvest Mouse Reithrodontomys montanus Western Harvest Mouse Reithrodontomys megalotis Fulvous Harvest Mouse Reithrodontomys fulvescens Cactus Mouse ... http://www.lastgreatplaces.org/SanPedro/espanol/biodiversity_mammals.html Last Great Places - San Pedro - Mamíferos: ...- ... campo de las praderas Reithrodontomys montanus Ratón de campo del oeste Reithrodontomys megalotis Ratón de campo leonado Reithrodontomys fulvescens Ratón de ... http://www.personal.psu.edu/users/e/i/eim104/b.o.nutr.htm Mode of Nutrition and Food Use: ...rats). This is noticeable because Reithrodontomys fulvescens (Fulvous mice) were more abundant than O. palustris in the habitat. ... http://www.edomexico.gob.mx/se/especies1.htm FAUNA: ...- ... 105) RATON DE CAMPO, Reithrodontomys chrysopsis chrysopsis Merriam, 1900 END. 106) RATON DE CAMPO, Reithrodontomys fulvescens mustelinus Howell, 1914 NA. ... http://entweb.clemson.edu/fireant/99conf/fap10.htm INFLUENCE OF FIRE ANT COLONY DENSITY ON FORAGING: ...cotton rat (Sigmodon hispidus), pygmy mouse (B. taylori), white-footed mouse (Peromyscus leucopus), and fulvous harvest mouse (Reithrodontomys fulvescens). ... http://dinets.travel.ru/mayensis.htm homepage of Vladimir Dinets - Guatemala: Guatemala. Harvest mice of Guatemalan mountains, left to right: Reithrodontomys fulvescens, R. sumichrasti, R. tenuirostris. Cotton ... http://199.245.200.220/bioone/?request=get-keyword-index&issn=0022-2372&volume=085 Journal of Mammalogy: Pteropus giganteus, [Abstract] [Full-text Article] [Print Version]. Reithrodontomys fulvescens, [Abstract] [Full-text Article] [Print Version]. ... http://www.esb.utexas.edu/philjs/stengl/lists/mammals.html Stengl Mammals: Rodentia, Sciuridae, Sciurus niger, Fox Squirrel. Geomyidae, Geomys attwateri, Attwater's Pocket Gopher. Muridae, *Reithrodontomys fulvescens Peromyscus leucopus ... http://www.ine.gob.mx/ueajei/publicaciones/libros/420/doce.html?id_pub=420 Instituto Nacional de Ecología: ...- ... Peromyscus aztecus, X. Peromyscus truei, X. X. X. X. Reithrodontomys sumichrasti, X. Reithrodontomys fulvescens, X. X. Reithrodontomys mexicanus, X. Sigmodon fulviventer, X. ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8395263&dopt=Abstract Genome organization of repetitive elements in the rodent ...: Hybridizing the library to genomic DNA from P. leucopus, Reithrodontomys fulvescens, Mus musculus, and human produced general agreement between phylogenetic ... http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&db=PubMed&orig_db=PubMed&dispmax=100&doptcmdl=DocSum&term=(harvest+mouse+OR+harvest+mice+OR+Reithrodontomys+fulvescens)+AND+(lyme+OR+burgdorferi+OR+(borreli*+AND+ixodes)+OR+((erythema+AND+migrans)+NOT+glossitis)+OR+garinii+OR+afzelii+OR+neuroborreli*) Entrez PubMed: Search PubMed ... http://www.shsu.edu/~bio_www/Mammals.html Mammals of the CEFS: Ochrotomys nutalli, Golden mouse. Neotoma floridana, Florida woodrat. Reithrodontomys fulvescens, Fulvous harvest mouse. Oryzomys pallustris, Rice rat. Order Carnivora, ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: CATTACTGGAAGCTAACACTGCCAGATATGCAAAAACAGGATCAAGTCAGTGTA >Reithrodontomys fulvescens breast cancer protein 1 (BRCA1) gene, exon 11 and partial cds ... http://www.biology.uc.edu/faculty/cameron/cameronpubs.htm Guy N. Cameron: In press. Characteristics of diet of Peromyscus aztecus and Reithrodontomys fulvescens in montane western Mexico. Journal of Mammalogy. ... http://www.cmc.edu/ppornelu/BI304/missouri_mammals.htm Checklist of Missouri Mammals The purpose of this page is to ...: Plains harvest mouse. Reithrodontomys megalotis. Western harvest mouse. Reithrodontomys fulvescens. Fulvous harvest mouse. Peromyscus maniculatus. Deer mouse. ... http://www.kingsnake.com/stha/nongame.html STHA Texas Parks and Wildlife Department - Nongame Regulations: Fulvous Harvest Mouse (Reithrodontomys fulvescens) Eastern Harvest Mouse (Reithrodontomys humulis) Western Harvest Mouse (Reithrodontomys megalotis) Plains ... http://www.siue.edu/BIOLOGY/facultypages/santanello99.htm Biology Faculty Home Page Template: A Histological and Ultrastructural Study of the Nephrons of Perognathus hispidus, With Comparisons to Reithrodontomys fulvescens." (Thesis). Back to top. ... http://www.museum.state.il.us/research/faunmap/query/taxalist.html Faunmap Taxa Code List: RYfu Reithrodontomys fulvescens (Fulvous harvest mouse) RYhs Reithrodontomys humulis (Eastern harvest mouse) RYme Reithrodontomys megalotis (Western harvest ... http://www.wtamu.edu/~rmatlack/Mammalogy/lab2.htm LAB: Oryzomys couesi Coues' rice rat Oryzomys palustris Marsh rice rat Reithrodontomys fulvescens Fulvous harvest mouse Reithrodontomys humulis Eastern harvest ... http://www.stollerdesign.com/jeremy/Portfolio/Portfolio.php?cat=mammals&image=harvestMouse Jeremy Stoller - Science Illustrator: Siberian Tiger. click image to view. Fulvous Harvest Mouse Fulvous Harvest Mouse. (Reithrodontomys fulvescens). ink & design marker on illustration board. 4" x 4". ... http://ipl.unm.edu/cwl/Metadata/azhdmsmammal.htm Arizona Heritage Data Management System (AZHDMS): Mammal: Specific_Taxonomic_Information: Order: RODENTIA Family: MURIDAE Genus: REITHRODONTOMYS Species: REITHRODONTOMYS FULVESCENS Applicable_Common_Names: FULVOUS ... http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/msiaccounts.html [an error occurred while processing this directive] Reithrodontomys fulvescens [an error occurred while processing this directive] 19407 Fulvous Harvest Mouse Fulvous Harvest Mouse Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |