|
|
Tatera robusta - Fring-Tailed GerbilIUCN Status: Lower Risk/Least ConcernIUCN Species Profile http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Tatera kempi. Tatera leucogaster. Tatera nigricauda. Tatera phillipsi. Tatera robusta. Tatera valida. Taterillus arenarius. Taterillus congicus. Taterillus emini. ... http://www.gerbil-info.com/html/species.htm Species: Tatera phillipsi (Phillip's gerbil). Ethiopia, Somalia, Kenya. Tatera robusta (Fringe-tailed gerbil). Guinea-Bissau to Somalia and central Tanzania. ... http://www.gerbils.pwp.blueyonder.co.uk/gerbils/species.htm Gerbil Species List: Tatera pringlei, Pringle's Gerbil, Northeastern Tanzania. Tatera robusta, Fringe-Tailed Gerbil, Guinea-Bissau to Somalia and Central Tanzania. ... http://www.und.ac.za/und/cogen/asmn/asmn2.html ASMN- page 2: Of the six species of small mammals trapped (five rodent and one insectivore species), Praomys natalensis (n=29) and Tatera robusta (n=8) were the most common. ... http://www.maik.rssi.ru/cgi-bin/search.pl?type=abstract&name=zooeng&number=2&year=97&page=251 zooeng2_97p251abs: Abstract—The discriminant analysis of skull parameters in three species of the group Tatera robusta from West Africa has justified the species distinctness ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: Tatera guineae Tatera inclusa Tatera indica Tatera kempi Tatera leucogaster Tatera nigricauda Tatera phillipsi Tatera pringlei Tatera robusta Tatera valida ... http://www.chez.com/rodent/Gerbillidae/Gerbillidae.html Gerbillidae: ...- ... Tatera phillipsi - Ethiopie, Somalie, Kenya. Tatera pringlei - NE Tanzanie. Tatera robusta - Fringe-tailed gerbil - Guinée-Bissau à la Somalie. ... http://www.ig-rennmaeuse.de/andererennmausarten.htm rennmausarten im ueberblick: ...- ... Boehm´s Gerbil (Tatera boehmi). Cape Gerbil (Tatera afra). Fringe-tailed Gerbil (Tatera robusta). Gorongoza Gerbil (Tatera inclusa). ... http://www.herforder-schulzoo.de/5038/?*session*id*key*=*session*id*val* Herforder Schulzoo: ...- ... Ägypt. Rennmaus, (Gerbillus gerbillus); 1,1 Nacktsohlenrennmaus, (Tatera robusta). Trugratten/Octodontidae. 3,3 Blaue Degus, (Octodon degus). Fledertiere. ... http://www.daimi.au.dk/~mheide/ME04/Datasets/BRCA1.fas Dendromus mesomelas breast cancer protein 1 (BRCA1) gene, exon 11 ...: CCAAGGAACTTGTCTATGGTTCTAAAGATGCTGGAAGTGACACAGAATGCTTTAAGCATCCATCGAAACA CGAGCTTAACCACATTCCAGAGACAGTAGAAATGGAAGGGAGTGAACTGGATACTCA >Tatera robusta breast cancer ... http://gerbil.info/species.htm SPECIES AND SUB SPECIES OF GERBILLINAE: Tatera phillipsi (Phillip's gerbil), Ethiopia, Somalia, Kenya. Tatera robusta (Fringe-tailed gerbil), Guinea-Bissau to Somalia and central Tanzania. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/refs/walker.ref-b.html Literature Cited, B: Studies of gerbils of genus Tatera: the specific distinction of Tatera robusta (Cretzschmar, 1826), Tatera nigricauda (Peters, 1878) and Tatera phillipsi (de ... http://www.savci.upol.cz/hlod-2.htm Rodentia - Hlodavci: ...pÃskomil Ä?ernoocasý - Black-tailed Gerbil Tatera phillipsi (de Winton, 1898) - pÃskomil Phillipsův - Phillip's Gerbil Tatera robusta (Cretzschmar, 1830 ... http://www.phthiraptera.org/Mammals/Muridae.html Mammals: Muridae: Polyplax taterae Ferris, 1923. Tatera phillipsi (de Winton, 1898) - Phillip´s Gerbil; Tatera robusta (Cretzschmar, 1830) - Fringe-tailed Gerbil ... http://www.gerbil-info.nl.com/litscience.htm SCIENTIFIC LITERATURE ON GERBILS: Perceptual and Motor Skills, 24: 473-4 EINIGE BEOBACHTUNGEN UEBER DAS VERHALTEN VON TATERA ROBUSTA (CRETZSCHMAR 1826) IN GEFANGENSCHAFT. Heisler, C. 1981. ... http://www.suanet.ac.tz/fvm/kilonzo%20vetpara.htm SUA - Faculty of Veterinary, Department of Microbiology and ...: The major rodent pest species in Tanzania are Mastomys natalensis, Arvicanthis niloticus, Tattus rattus, Mus musculus, and in some localities, Tatera robusta. ... http://diglib1.amnh.org/novitates/congo/nov791.html American Museum of Natural History Publications: 791 - - NOTE 0 - 500 - a Title from caption. - - NOTE 1 - 500 - a "April 11, 1935." - - NOTE 2 - 500 - a Specimen of Tatera robusta taylori collected by HE ... http://www.signaling-gateway.org/molecule/query?afcsid=A001442&type=blast&adv=latest Blast data for AfCS protein A001442 - Signaling Gateway: 1.12E-3, 45.0542, 25.58, 48.02, c-myc [Tatera robusta ... http://www.blackwell-synergy.com/links/doi/10.1034/j.1600-0706.2003.11763.x/abs/ Foraging of multimammate mice, Mastomys natalensis, under ...: 53 (3.5%) were Tatera robusta, 25 (1.5%) were Lemniscomys striatus (a day-active animal) and 8 animals (0.5%) were Crocidura spp. shrews. ... http://www.zmuc.dk/commonweb/research/biodata_sources_mammals.htm Sources for compilation of Africa databases: mammals: Studies of gerbils of genus Tatera: the specific distinction of Tatera robusta (Cretzschmar, 1826), Tatera nigricauda (Peters, 1878) and Tatera phillipsi (De ... http://www.cabsubsets.org/cabsframe/thes/t.htm CABI ALPHABETICAL THESAURUS (June 1999) - T: ...proteins tata box TN: LT00146 HN: from 1994 BT: promoters Tatera TN: NW10983 BT: Gerbillinae NT: Tatera robusta RT: gerbils Tatera robusta TN: NW10984 BT ... http://www.esapubs.org/archive/ecol/E084/094/MOMv3.3.txt [an error occurred while processing this directive] Tatera robusta [an error occurred while processing this directive] 21519 Fring-Tailed Gerbil Fring-Tailed Gerbil Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |