|
|
Zygogeomys trichopus - Michoacan Pocket GopherIUCN Status: [an error occurred while processing this directive]IUCN Species Profile http://www.itis.usda.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=625200 ITIS Standard Report Page: Zygogeomys: Genus, Zygogeomys Merriam, 1895, Direct Children: Species, Zygogeomys trichopus Merriam, 1895 -- Michoacan pocket gopher, References, Expert(s): ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/Zygogeomys_trichopus.html ADW: Zygogeomys trichopus: Classification: Zygogeomys trichopus (Michoacan pocket gopher and tuza). Classification. What do these icons mean? The icons tell you what features are available for that taxon. ... http://animaldiversity.ummz.umich.edu/site/accounts/classification/path/Zygogeomys_trichopus.html.html ADW: Zygogeomys trichopus: Classification: Zygogeomys trichopus (Michoacan pocket gopher and tuza). Classification. ... Species Zygogeomys trichopus (Michoacan pocket gopher and tuza). ... http://www.fact-index.com/g/ge/geomyidae.html Geomyidae: T. townsendii, Townsend s Pocket Gopher; T. umbrinus, Southern Pocket Gopher. Zygogeomys. Zygogeomys trichopus, Michoacan Pocket Gopher or Tuza. External links. ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.rodentia.geomyidae.zygogeomys.html Thumbnails Page, Rodentia Geomyidae Zygogeomys: Rodentia Geomyidae Zygogeomys (Click on thumbnail to view larger image). Tuza (Zygogeomys trichopus), photo by Mark S. Hafner. (Click ... http://www.press.jhu.edu/books/walkers_mammals_of_the_world/rodentia/images/image.mid.rodentia.geomyidae.zygogeomys.trichopus.1.html Image Page, Rodentia Geomyidae Zygogeomys: Rodentia Geomyidae Zygogeomys. Tuza (Zygogeomys trichopus), photo by Mark S. Hafner. Return to Genus Copyright © 1997 by the Johns Hopkins University Press. http://www.chez.com/rodent/Geomyidae/Geomyidae.html Geomyidae: 1829. Genus Zygogeomys. Zygogeomys trichopus - Michoacan pocket gopher - Michoacan - Merriam -1895. Genus Cratogeomys. Cratogeomys ... http://www.interaktv.com/mammals/Rodentia2myo.html Biologybase: Mammals of the World: Rodentia 2 (Myomorpha): Thomomys townsendii. Thomomys umbrinus. Zygogeomys trichopus. Heteromyidae, Dipodomyinae, Dipodomys agilis. Dipodomys californicus. Dipodomys compactus. ... http://www.free-definition.com/Geomyidae.html Geomyidae Definition Meaning Information Explanation: T. townsendii, Townsend´s Pocket Gopher; T. umbrinus, Southern Pocket Gopher. Zygogeomys. Zygogeomys trichopus, Michoacan Pocket Gopher or Tuza. External links. ... http://www.ine.gob.mx/ueajei/publicaciones/libros/420/veintiseis.html?id_pub=420 Instituto Nacional de EcologÃa: ...- ... Sylvilagus floridanus ) . con 16.2% y las tuzas ( Cratogeomys spp. y Zygogeomys trichopus .) con 8.8% de consumo. Las otras especies ... http://www.worldhistory.com/wiki/G/Geomyidae.htm Geomyidae: Zygogeomys. Zygogeomys trichopus, Michoacan Pocket Gopher or Tuza. External links. http://www.natureserve.org/explorer/speciesIndex/Family_GEOMYIDAE_100248_1.htm. ... http://www.animalinfo.org/country/mexico.htm Animal Info - Mexico: ...(Endemic to Mexico.); Mexican Prairie Dog (Cynomys mexicanus). (Endemic to Mexico.); Michoacan Pocket Gopher (Zygogeomys trichopus). ... http://members.tripod.com/~Nager/dic3.htm Rodent Dictionary: ...- ... ssp. Gelbe und Zimtfarbene Taschenratten, ---. Tuza, Michoacan pocket gopher, Zygogeomys trichopus, Tuza, Rat à poche mexicain. Kangaroo ... http://members.tripod.com/rodentvzw/rodentfrans/Taxonomie/geomyidae.htm Geomyidae: Thomomys talpoides. Thomomys townsendii. Thomomys umbrinus. Zygogeomys. Zygogeomys trichopus. Last update 13/04/2003. © Rodent vzw. rodent@ibelgique.com. http://tariacuri.crefal.edu.mx/sigapatz/estudios/estribo_grande/estrib10c.html Pagina nueva 1: ...- ... 13. Thomomys umbrinus. Tuza chica. A. 14. Glaucomys volans. Ardilla voladora. A. 15. Zygogeomys trichopus. Tuza de Michoacán. ES. P. 16. Orthogeomys grandis. Tuza grande. 17. ... http://www.museum.lsu.edu/MNS/mammcoll.html LSUMNS - Collections - Mammals: ...as Tomopeas ravus, from Peru, Mexican and Central American pocket gophers ,including several specimens of the rare species, Zygogeomys trichopus, from Mexico ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/ClasRode.html Classification des Rodentiens: Thomomys clusius Thomomys idahoensis Thomomys mazama Thomomys monticola Thomomys talpoides Thomomys townsendii Thomomys umbrinus Zygogeomys trichopus. ... http://perso.club-internet.fr/boudetjo/ZooList/Mammif/DangSciu.html Sciuromorphes en danger: Campbell. Arizona, Wildlife : endangered. Zygogeomys trichopus, Gaufre à poches du Michoacan, Michoacan pocket gopher. Merriam, 1895. ... http://www.natureserve.org/infonatura/speciesIndex/Family_Geomyidae_100248_1.htm InfoNatura Species Index: Family Geomyidae: AMAFC01010, Thomomys umbrinus Southern Pocket Gopher, G5, Countries: MX. LMTC005010, Zygogeomys trichopus Michoacan Pocket Gopher, G4, EN, Countries: MX. ... http://www.fmnh.helsinki.fi/users/haaramo/Metazoa/Deuterostoma/Chordata/Synapsida/Eutheria/Rodentia/Myomorpha/Geomyini.htm Geomyidae: Geomyinae: Geomyini: ...paljaskuonotaskurotta) | |-- C. zinseri (zinser's pocket gopher) | `-- C. gymnurus (llano pocket gopher) |-- Zygogeomys trichopus (mitsoakantaskurotta) `--o ... http://www.phthiraptera.org/Mammals/Geomyidae.html Mammals: Geomyidae: 1980) *. Zygogeomys. Zygogeomys trichopus Merriam, 1895 - Michoacan Pocket Gopher Geomydoecus mcgregori Price and Emerson, 1971. Geomydoecus ... http://www.cricyt.edu.ar/INSTITUTOS/iadiza/ojeda/1-10-36biogeogr.htm Circular Guanabios 1(10):36: ...- ... La tuza michoacana (Zygogeomys trichopus), por ejemplo, subsiste en poblaciones muy pequeñas restringidas a las zonas boscosas de unos cuantos sitios de ... http://www.biomercado.org/eco/Fauna_Animales_en_extincion/mamiferos-mx.htm ecoargentina: ...- ... Pappogeomys fumosus, -, Amenazada. Pappogeomys neglectus, -, Amenazada. Zygogeomys trichopus, -, En peligro de extinción. Familia: Heteromyidae. ... http://bioweb.pasteur.fr/docs/doc-gensoft/bambe/Data/gophers.dna 13 379 # category-list=(3,1,2)* # Geomys personatus ...: TATCAAACTCATCATTAGATATCGTATTA Zygogeomys trichopus AGAAGTTTACATTCTAATCCTCCCTGGCTTCGGTATAATCTCACACATTGTCACCTACTATTCAGGCAAA ... http://www.specola.unifi.it/evaidc/RedList.idc?class=MAMMALIA&order=&family=&status=1 EVA - List -: ...- ... MAMMALIA, Rodentia, Dipodidae, Zapus hudsonius preblei, MAMMALIA, Rodentia, Geomyidae, Zygogeomys trichopus, MAMMALIA, Rodentia, Heteromyidae, Dipodomys gravipes, ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC4/Data/TAXON/GEOMY.txt ME MYPARENT RORDER NAME TAXON PRINTNAME AUTHOR CITATION COMMON_NM ...: N. Am. Fauna, 8:195. <^Zygogeomys trichopus^> Merriam, 1895. see below for species. 42 41 0 trichopus SPECIES Zygogeomys trichopus Merriam, 1895. N. Am. ... http://www.rickertweb.com/~justin/School/CS360%20Database%20Systems/PC2/SQL/2f.txt SQL> @c:\2f.sql NAME PRINTNAME ...: ...gopher. umbrinus Thomomys umbrinus Southern pocket gopher. trichopus Zygogeomys trichopus Michoacan pocket gopher. NAME PRINTNAME ... http://www.rodent.be/rodentfrans/Taxonomie/geomyidae.htm Geomyidae: Thomomys talpoides. Thomomys townsendii. Thomomys umbrinus. Zygogeomys. Zygogeomys trichopus. Last update 08-05-2004 01:10:04. © Rodent vzw. info@rodent.be. http://www.esajournals.org/esaonline/?request=get-document&issn=1051-0761&volume=008&issue=01&page=0008 ASSESSING CONSERVATION PRIORITIES IN MEGADIVERSE MEXICO: MAMMALIAN ...: ...kangaroo rat (Dipodomys gravipes), and several species of pocket gophers (eg, Pappogeomys zinzeri, Geomys tropicalis, Zygogeomys trichopus), are dispersed ... http://www.virologia.unimi.it/~prea/rodents/lists/endangered.html Rodent Specialist Group - Endangered species: Family: GEOMYIDAE. Zygogeomys trichopus (Michoacan Pocket Gopher) Red List: EN A1c, B1+2ac (Baillie, J.) Distribution: Mexico. Family: HETEROMYIDAE. ... http://www.ibiologia.unam.mx/cnma/nativos.html MAMIFEROS TERRESTRES NATIVOS DE MEXICO: ...- ... 240.- Thomomys bottae (Eydoux y Gervais, 1836). 241.- Thomomys umbrinus (Richardson, 1829). 242.- Zygogeomys trichopus Merriam, 1895 **. FAMILIA HETEROMYIDAE. ... http://www.ibiologia.unam.mx/cnma/lista.html LISTA TAXONOMICA DE LOS MAMIFEROS TERRESTRES DE MEXICO: ...- ... Richardson, 1829) Thomomys umbrinus vulcanius Nelson y Goldman, 1934 Thomomys umbrinus zacatecae Nelson y Goldman, 1934 Zygogeomys trichopus Merriam, 1895 ... http://www.lacim.uqam.ca/~chauve/Enseignement/BIF7002/Rapports/Youssef-Nassiri/fichiers/DNA_MT.fasta gi|548217|gb|L32682.1|POGCYTOXIA Thomomys bottae mitochondrial ...: TATTCAACTCATCATTAGATATTGTATTA >gi|548333|gb|L32695.1|ZYOCYTOXIA Zygogeomys trichopus mitochondrial cytochrome oxidase I gene, partial cds ... http://www.savci.upol.cz/hlod-1.htm Rodentia - Hlodavci: Southern Pocket Gopher. Zygogeomys trichopus Merriam, 1895 - pytlonoÅ¡ taltuza - Michoacan Pocket Gopher. ÄŒeleÄ?: pytlouÅ¡ovità ... http://www.planeta.com/ecotravel/mexico/parques/michoacan2.html Parques Nacionales de Mexico/Planeta.com: ...- ... y S. floridans), ardillas (Sciurus aureogaster y Glaucomys volans), tuzas (Orthogeomys grandis, Pappogeomys gymnurus y Zygogeomys trichopus), tucita (Lyomis ... http://industry.ebi.ac.uk/~alan/BioWidget/Taxonomy/tax4.data 1 root 1 2759 Eukaryotae 1 42452 unclassified eukaryotes 2759 ...: Orthogeomys heterodus 35661 35665 Orthogeomys hispidus 35661 35666 Orthogeomys underwoodi 35661 35667 Zygogeomys 10010 35668 Zygogeomys trichopus 35667 13627 ... http://www.conabio.gob.mx/institucion/conabio_espanol/doctos/ceballos.html Ã?reas prioritarias para la conservación de los mamÃferos de ...: ...- ... insonus). Liebre de Tehuantepec (Lepus flavigularis). Tuza de Nahuatzen (Zygogeomys trichopus). Tuza de Zinzer (Pappogeomys zinzeri). ... http://xextdb.nibb.ac.jp:8080/cgi-bin/db/ShowBlastList.sh?solver=blastn Result of blastn: 200005221422 XLF00128 n26g8 8e-40 167 L32695 L32695 ZYOCYTOXIA circular DNA 379 Zygogeomys trichopus mitochondrial cytochrome oxidase I gene, partial cds. ... http://www.astronomy.net/forums/god/messages/23231.shtml?&disp=0&disp=0 [an error occurred while processing this directive] Zygogeomys trichopus [an error occurred while processing this directive] 23323 Michoacan Pocket Gopher Michoacan Pocket Gopher Home | Search | About |
|
Copyright SpeciesList.com 2003-2009 |